US Patent Application 2007-0092549 A1

United States Patent Application	*20070092549*
Kind Code	A1
Tuszynski; Jack A. ; et al.	April 26, 2007

Water-soluble compound

Abstract

A water-soluble magnetic anti-mitotic compound with a water-solubility of at least 100 micrograms per milliliter, a molecular weight of at least 150 grams per mole, a mitotic index factor of at least 10 percent, a positive magnetic susceptibility of at least 1,000.times.10.sup.-6 cgs, and a magnetic moment of at least 0.5 bohr magnetrons, wherein said compound is comprised of at least 7 carbon atoms and at least one inorganic atom with a positive magnetic susceptibility of at least 200.times.10.sup.-6 cgs.

Inventors:	Tuszynski; Jack A.; (Edmonton, CA) ; Greenwald; Howard J.; (East Rochester, NY) ; Curry; Stephen H.; (Rochester, NY) ; Goss; Kendrick; (Brighton, MA)
Correspondence Name and Address:	BUCHANAN, INGERSOLL & ROONEY PC POST OFFICE BOX 1404 ALEXANDRIA VA 22313-1404 US
Serial No.:	063441
Series Code:	11
Filed:	February 23, 2005

U.S. Current Class:	424/423; 427/2.24; 514/449
U.S. Class at Publication:	424/423; 514/449; 427/002.24
Intern'l Class:	A61F 2/20 20060101 A61F002/20; A61K 31/337 20060101 A61K031/337

Claims

1. A process for treating a stent comprising the steps of a. applying a magnetic field to a patient such that said magnetic field acts upon a stent wherein i. said stent is disposed within a lumen of said patient, said stent having a first magnetic moment, said stent being further comprised of means to change said first magnetic moment to a second magnetic moment, ii. said stent is comprised of a substrate wherein said substrate is comprised of a biologically active substrate and a magnetic moiety wherein: 1. said biologically active substrate is an anti-mitotic agent, 2. said magnetic moiety is covalently bound to said biologically active substrate, said magnetic moiety having a third magnetic moment, iii. said third magnetic moment and said first magnetic moment are such that there is an attractive force between said stent and said substrate, iv. said second magnetic moment and said first magnetic moment are such that there is a repulsive force between said stent and said substrate, b. in response to said magnetic field, said first magnetic moment of said stent changes to said second magnetic moment, thereby causing said substrate to be repelled by said stent.

2. The process for treating a stent as recited in claim 1, wherein said stent is further comprised of plaque.

3. The process for treating a stent as recited in claim 2, wherein said biologically active substrate reduces the amount of said plaque.

4. The process for treating a stent as recited in claim 3, wherein said biologically active substrate is a taxane.

5. The process for treating a stent as recited in claim 4, wherein said taxane is a paclitaxel.

6. The process for treating a stent as recited in claim 5, said magnetic moiety is comprised of a iron atom with a positive magnetic susceptibility of at least 2.times.10.sup.4 cgs,

7. A process for treating a stent comprising the steps of a. applying a magnetic field to a patient such that said magnetic field acts upon a stent wherein i. said stent is disposed within a lumen of said patient, said stent having a first magnetic moment, said stent being further comprised of means to change said first magnetic moment to a second magnetic moment, ii. said stent is comprised of a substrate wherein said substrate is comprised of a biologically active substrate and a magnetic moiety wherein: 1. said biologically active substrate is an antimitotic agent, 2. said magnetic moiety is covalently bound to said biologically active substrate, said magnetic moiety having a third magnetic moment iii. said third magnetic moment and said first magnetic moment are such that there Is a repulsive force between said stent and said substrate, iv. said second magnetic and said first magnetic moment are such that there is an attractive force between said stent and said substrate, b. in response to said magnetic field, said first magnetic moment of said stent changes to said second magnetic moment, thereby causing said substrate to be attracted to said stent.

8. The process for treating a stent as recited In claim 7, further comprising the step of administering a replenishment substrate to said lumen, wherein said replenishment substrate is comprised of a biologically active substrate and a magnetic moiety wherein; a. said biologically active substrate is an anti-mitotic agent, b. said magnetic moiety is covalently bound to said biologically active substrate, said magnetic moiety having a fourth magnetic moment, c. said second magnetic and said fourth magnetic moment are such that there is an attractive force between said stent and said replenishment substrate.

9. The process for treating a stent as recited in claim 8, wherein, in response to said magnetic field, said first magnetic moment of said stent changes to said second magnetic moment, thereby causing said replenishment substrate to be attracted to said stent.

10. The process for treating a stent as recited in claim 9, wherein said stent is further comprised of a drug eluting polymer wherein said substrate is disposed within said drug eluting polymer.

11. The process for treating a stent as recited in claim 10, wherein said replenishment substrate becomes disposed within said drug eluting polymer by the action of said magnetic field.

12. The process for treating a stent as recited in claim 11, wherein said replenishment substrate and said substrate have the same molecular structure.

13. The process for treating a stent as recited in claim 12, wherein said lumen of said patient is a blood vessel.

14. A process for treating a stent comprising the steps of a. applying a magnetic field to a patient such that said magnetic field acts upon a stent wherein i. said stent is disposed within a lumen of said patient, said stent having a first magnetic moment, said stent being further comprised of means to change said first magnetic moment to a second magnetic moment, ii. said stent is comprised of a substrate wherein said substrate is comprised of a biologically active substrate and a magnetic moiety wherein: 1. said biologically active substrate is a taxane, 2. said magnetic moiety is covalently bound to said biologically active substrate, said magnetic moiety having a third magnetic moment, iii. said third magnetic moment and said first magnetic moment are such that there is an attractive force between said stent and said substrate, iv. said second magnetic and said first magnetic moment are such that there is a repulsive force between said stent and said substrate, b. in response to said magnetic field, said first magnetic moment of said stent changes to said second magnetic moment, thereby causing said substrate to be repelled by said stent.

15. The process for treating a stent as recited in claim 14, wherein a. said magnetic moiety is comprised of a iron atom with a positive magnetic susceptibility of at least 2.times.10.sup.-4 cgs, and b. said substrate has a positive magnetic susceptibility of at least 1.times.10.sup.-3 cgs.

16. The process for treating a stent as recited in claim 15, wherein said magnetic moiety is further comprised of a hydroxamic acid.

17. The process for treating a stent as recited in claim 16, wherein said hydroxamic acid is a ferrichrome.

18. The process for treating a stent as recited in claim 16, wherein said hydroxamic acid is a ferrioxamine.

19. The process for treating a stent as recited in claim 15, wherein said magnetic moiety is a siderophore.

20. The process for treating a stent as recited in claim 19, wherein said siderophore is a catecholate.

Description

CROSS-REFERENCE TO RELATED PATENT APPLICATIONS

[0001] This application is a continuation of applicants' co-pending patent application U.S. Ser. No. 10/923,615, filed on Aug. 20, 2004 which claims priority from United States provisional patent application U.S. Ser. No. 60/516,134, filed on Oct. 31, 2003. The entire disclosure of each of these patent applications is hereby incorporated by reference into this specification.

[0002] This application is a continuation-in-part of applicants' U.S. patent application Ser. No. 10/808,618 (filed on Mar. 24, 2004), of applicants' U.S. patent application Ser. No. 10/867,517 (filed on Jun. 14, 2004), and of applicants' U.S. patent application Ser. No. 10/878,905(filed on Jun. 28, 2004). The entire disclosure of each of these patent applications is hereby incorporated by reference into this specification.

INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ON A COMPACT DISC

[0003] Reference is hereby made to a Sequence Listing, a Table, and/or a Computer Program Listing appendix that was submitted on compact disc. The entire content of this compact disc is hereby incorporated by reference into this specification.

FIELD OF THE INVENTION

[0004] A water-soluble magnetic anti-mitotic compound with a water-solubility of at least 100 micrograms per milliliter, a molecular weight of at least 150 grams per mole, a mitotic index factor of at least 10 percent, a positive magnetic susceptibility of at least 1,000.times.10.sup.-6 cgs, and a magnetic moment of at least 0.5 bohr magnetrons, wherein said compound is comprised of at least 7 carbon atoms and at least one inorganic atom with a positive magnetic susceptibility of at least 200.times.10.sup.-6 cgs.

BACKGROUND OF THE INVENTION

[0005] Paclitaxel is a complex diterpenoid that is widely used as an anti-mitotic agent; it consists of a bulky, fused ring system and an extended side chain that is required for its activity. See, e.g., page 112 of Gunda I. Georg's "Taxane Anticancer Aents: Basic Science and Current Status," ACS Symposium Series 583 (American Chemical Society, Washington, D.C., 1995).

[0006] The aqueous solubility of paclitaxel is relatively low. Thus, as is disclosed at page 112 of such Georg text, estimates of paclitaxel solubility vary widely, ranging from about 30 micrograms per milliliter and about 7 micrograms per milliliter to less than 0.7 micrograms per milliter.

[0007] The molecular weight of paclitaxel is in excess of 700; this relatively high molecular weight is one factor that, according to the well-known "rule of 5," contributes to paclitaxel's poor water solubility.

[0008] The "rule of 5" was set forth by Christopher A. Lipinski et al. in an article entitled "Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings," Adv. Drug Delivery Rev., 1997, 23(1-3), 3-25. In this article, it was disclosed that: "In the USAN set we found that the sum of Ns and Os in the molecular formula was greater than 10 in 12% of the compounds. Eleven percent of compounds had a MWT of over 500 . . . . The `rule of 5` states that: poor absorption of permeation is more likely where: A. There are more than 5 H-bond donors (expressed as the sum of OHs and NHs); B. The MWT is over 500; C. The LogP is over 500 . . . ; D. There are more than 10 H-bond acceptors (expressed as the sum of Ns and Os)."

[0009] The Lipinksi "rule of 5" has also erroneously been referred to as the "Pfizer rule of 5," as is illustrated by U.S. Pat. No. 6,675,136, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in such patent, "To further illustrate the versatility of the present technique, we also introduce the concept of `anchor` objects. Anchor objects are molecules situated at the corners of a region of the drug space that is defined by Pfizer's `rule of 5`. This rule has been empirically derived by a computer analysis of known drugs, as described by Christopher A. Pfizer and co-workers in Adv. Drug Delivery Rev., vol. 23, pp. 3-25 (1997). The `rule of 5" is focused on drug permeability and oral absorption . . . . According to Pfizer's "rule of 5", LIPO and HBDON are between 0 and 5, HBACC is between 0 and 10, and M.W. has a maximum of 500."

[0010] The problems that high molecular weight compounds have with poor water solubility are discussed in U.S. Pat. No. 6,667,048 of Karel J. Lambert et al., which discloses an "emulsion vehicle for a poorly soluble drug." In the "background of the invention" section of this patent, it is disclosed that: "Hundreds of medically useful compounds are discovered every year, but clinical use of these drugs is possible only if a drug delivery vehicle is developed to transport them to their therapeutic target in the human body. This problem is prticularly critical for drugs requiring intraveneous injection in order to reach their therapeutic target or dosage but which are water insoluble or poorly water insoluble. For such hydrophobic compounds, direct injection may be impossible or highly dangerous, and can result in hemolysis, phlebitis, hypersensitivity, organ failure and/or death. Such compounds are termed by pharmacists `lipophilic,` `hydrophobic,` or in their most difficult form, `aamphiphobic` . . . . A few examples of therapeutic substances in these categories are ibuprofen, diazepam, grisefulvin, cyclosporin, cortisone, proleukin,cortisone, proleukin, etoposide and paclitaxel . . . ."

[0011] As is also disclosed in U.S. Pat. No. 6,667,048, "Administration of chemotherapuetic or anti-cancer agents is particularly problematic. Low solubility anti-cancer agents are difficult to solubulize and supply at therapeutically useful levels. On the other hand, water-soluble anti-cancer agents are generally taken up by both cancer and non-cancer cells thereby exhibiting non-specificity . . . . Efforts to improve water-solubility and comfort of administration of such agents have not solved, and may have worsened, the two fundamental problems of cancer chemotherapy: 1) non-specific toxicity, and 2)rapid clearance from the bloodstream by non-specific mechanisms. In the case of cytotoxins, which form the majority of currently available chemotherapies, these two problems are clearly related. Whenever the therapeutic is taken up by noncancerous cells, a diminished amount of thedrug remains available to treat the cancer, and more importantly, the normal cell ingesting the drug is killed."

[0012] As is also disclosed in U.S. Pat. No. 6,667,048, "The chemotherapeutic must be present throughout the affected tissue(s) at high concentration for a sustained period of time so that it may be taken up by the cancer cells, but not at so high a concentration that normal cells are injured beyond repair. Obviously, water-soluble molecules can be admistered in this way, but only by slow, continuous infusion and monitoring, aspects which entail great difficulty, expense and inconvenience."

[0013] It does not appear that the prior art has provided a water-soluble anti-mitotic agent that is capable of solving the problems discussed in U.S. Pat. No. 6,667,048. It is an object of this invention to provide such an agent. In particular, and in one embodiment, it is an object of this invention to provide a magentic anti-mitotic composition that can be directed to be more toxic to cancer cells than normal cells. Furthermore, and in another embodiment, it is another object of this invention to provide a delivery system that will provide a chemotherapeutic agent at a high concentration for a sustained period of time but not at such a high concentration that a substantial number of normal cells are injured beyond repair.

SUMMARY OF THE INVENTION

[0014] In accordance with one embodiment of this invention, there is provided a water-soluble magnetic anti-mitotic compound with a water-solubility of at least 100 micrograms per milliliter, a molecular weight of at least 150 grams per mole, a mitotic index factor of at least 10 percent, a positive magnetic susceptibility of at least 1,000.times.10.sup.-6 cgs, and a magnetic moment of at least 0.5 bohr magnetrons, wherein said compound is comprised of at least 7 carbon atoms and at least one inorganic atom with a positive magnetic susceptibility of at least 200.times.10.sup.-6 cgs.

[0015] In accordance with yet another embodiment of this invention, there is provided a compound with molecular weight of at least about 550, a wter solubility of at least about 10 micrograms per milliliter, a pKa dissociation constant of from about 1 to about 15, and a partition coefficient of from about 1.0 to about 50.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The invention will be described with referene to the specification and the enclosed drawings, in which like numerals refer to like elements, and wherein:

[0017] FIG. 1 is a schematic illustration of one preferred implantable assembly of the invention;

[0018] FIG. 2 is a schematic illustration of a flow meter that may be used in conjunction with the implantable assembly of claim 1;

[0019] FIG. 3 is a flow diagram of one preferred process of the invention;

[0020] FIG. 4 is a flow diagram of another preferred process of the invention; and

[0021] FIG. 5 is a flow diagram of yet another preferred process of the invention.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] The magnetic anti-mitotic compound of this invention is particularly well-adapted to bind either to tubulin isotypes and/or microtubules comprised of such isotypes and/or various proteins that are involved in microtubule dynamics. In the first part of this specification, applicants will discuss the preparation of a database of tubulin isotopes. In the second part of this specification, applicants will discuss certain preferred, magnetic compounds that, in one embodiment, target such tubulin isotypes and/or the microtubules they make up.

A Process for Preparing a Tubulin Isotype Database

[0023] Tubulin is a component of microtubules. At the molecular level tubulin's roles are highly complex. For example, microtubules undergo cycles of rapid growth and disassembly in a process known as "dynamic instability" that appears to be critical for microtubule function. In one embodiment, the magnetic anti-mitotic compounds of this invention are capable of disrupting and/or modifying such process of "dynamic instability," either by interacting with one or more tubulin isotypes, and/or one or more proteins involved in the dynamics of microtubule assembly and/or disassembly, and/or the microtubules themselves.

[0024] Both the alpha and the beta forms of tubulin consist of a series of isotypes, differing in amino acid sequence, each one encoded by a different gene. See, e.g., an article by Richard F. Luduena on "The multiple forms of tublin: different gene products and covalent modifications," Int. Rev. Cytol. 178-107-275 (1998). Reference also may be had, e.g., to U.S. Pat. No. 6,306,615 (detection method for monitoring beta-tubulin isotype specific modification); the entire disclosure of this United States patent is hereby incorporated by reference into this specification.

[0025] An interesting discussion of tubulin isotypes is also presented in published United States patent application 2004/0121351, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in this published patent application, "Microtubules are essential to the eucaryotic cell due as they are involved in many processes and functions such as, e.g., being components of the cytoskeleton, of the centrioles and ciliums and in the formation of spindle fibres during mitosis. The constituents of microtubules are heterodimers consisting of one .alpha.-tubulin molecule and one .beta.-tubulin molecule. These two related self-associating 50 kDa proteins are encoded by a multigen family. The various members of this multigen family are dispersed all over the human genome. Both .alpha.-tubulin and .beta.-tubulin are most likely to originate from a common ancestor as their amino acid sequence shows a homology of up to 50%. In man there are at least 15 genes or pseudogenes for .beta.-tubulin."

[0026] As is also disclosed in published United States patent application 2004/0121351, "The conservation of structure and regulatory functions among the .beta.-tubulin genes in three vertebrate species (chicken, mouse and human) allowed the identification of and categorization into six major classes of beta-tubulin polypeptide isotypes on the basis of their variable carboxyterminal ends. The specific, highly variable 15 carboxyterminal amino acids are very conserved among the various species. Beta-tubulins of categories I, II, and IV are closely related differing only 2-4% in contrast to categories III, V and VI which differ in 8-16% of amino acid positions [Sullivan K. F., 1988, Ann. Rev. Cell Biol. 4: 687-716] . . . the expression pattern is very similar between the various species as can be taken from the following table [Sullivan K. F., 1988, Ann. Rev. Cell Biol. 4: 687-716] which comprises the respective human members of each class: 1 isotype member expression pattern class I HM 40 ubiquitous class II H .beta. 9 mostly in the brain class III H .beta. 4 exclusively in the brain class IVa H .beta. 5 exclusively in the brain class IVb H .beta. 2 ubiquitous . . . ." The C terminal end of the beta-tubulins starting from amino acid 430 is regarded as highly variable between the various classes. Additionally, the members of the same class seem to be very conserved between the various species. As tubulin molecules are involved in many processes and form part of many structures in the eucaryotic cell, they are possible targets for pharmaceutically active compounds. As tubulin is more particularly the main structural component of the microtubules it may act as point of attack for anticancer drugs such as vinblastin, colchicin, estramustin and taxol which interfere with microtubule function. The mode of action is such that cytostatic agents such as the ones mentioned above, bind to the carboxyterminal end the .beta.-tubulin which upon such binding undergoes a conformational change. For example, Kavallaris et al. [Kavallaris et al. 1997, J. Clin. Invest. 100: 1282-1293] reported a change in the expression of of specific .beta.-tubulin isotypes (class I, II, III, and IVa) in taxol resistant epithelial ovarian tumor. It was concluded that these tubulins are involved in the formation of the taxol resistence. Also a high expression of class III .beta.-tubulins was found in some forms of lung cancer suggesting that this isotype may be used as a diagnostic marker."

[0027] The function of certain tubulins in Taxol resistance was also discussed in U.S. Pat. No. 6,362,321, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in this patent, "Taxol is a natural product derived from the bark of Taxus brevafolio (Pacific yew). Taxol inhibits microtubule depolymerization during mitosis and results in subsequent cell death. Taxol displays a broad spectrum of tumorcidal activity including against breast, ovary and lung cancer (McGuire et al., 1996, N. Engld. J. Med. 334:1-6; and Johnson et al., 1996, J. Clin. Ocol. 14:2054-2060). While taxol is often effective in treatment of these malignancies, it is usually not curative because of eventual development of taxol resistance. Cellular resistance to taxol may include mechanisms such as enhanced expression of P-glycoprotein and alterations in tubulin structure through gene mutations in the .beta. chain or changes in the ratio of tubulin isomers within the polymerized microtubule (Wahl et al., 1996, Nature Medicine 2:72-79; Horwitz et al., 1993, Natl. Cancer Inst. 15:55-61; Haber et al., 1995, J. Biol. Chem. 270:31269-31275; and Giannakakou et al., 1997, J. Biol. Chem. 272:17118-17125) . . . ." In one embodiment of this invention, the magnetetic anti-mitotic compound of this invention is used in conjunction with paclitaxel to provide an improved anti-cancer composition. Without wishing to be bound to any particular theory, applicants believe that their anti-mitotic compound targets a tubulin isotype that is responsible for the drug resistance to paclitaxel.

[0028] The increased presence of certain tubulin isotypes associated with certain types of cancers was noted in an article by Tien Yeh et al., "The B.sub.II Isotype of Tubulin is Present in the Cell Nuclei of a Variety of Cancers," Cell Motility and the Cytoskeleton 57:96-106 (2004). Constructs of these B.sub.II isotypes and applicants' magnetic anti-mitotic compound comprise one embodiment of the present invention.

[0029] The Yeh et al. article discloses that both alpha-tubulin and beta-tubulin consist of a series of isotypes differieng in amino acid sequence, each one encoded by a different gene; and it refers to a 1998 article by Richard F. Luduena entitled "The multiple forms of tubulin: different gene products and covalent modifications," Int. Rev. Cytol 178:207-275. The Yeh et al. article also disclosed that the B.sub.II isotype of tubulin is present in the nuclei of many tumors, stating that "Three quarters (75%) of the tumors we examined contained nuclear the B.sub.II (Table I)." The authors of the Yeh et al. article suggest that (at page 104) " . . . it would be interesting to expore the possibility of using nuclear B.sub.II as a chemotherapeutic target."

[0030] It thus appears that many isotypes of tubulin might be "chemotherapeutic targets" such as, e.g., the "nuclear B.sub.II" disclosed in the Yeh et al. article, or the " . . . specific .beta.-tubulin isotypes (class I, II, III, and IVa) . . ." described in the Kavallaris et al. article (Kavallaris et al. 1997, J. Clin. Invest. 100: 1282-1293) and discussed in published United States patent application 2004/0121351. It also appears that many isotypes of tubulin are " . . . targets for pharmaceutically active compounds . . . ." The process of this invention may be used to identify these tubulin isotype targets, to model such targets, and to determine what therapeutic agents interact with such targets; and it may also be used to assist in the construction of anti-mitotic agents bound to such isotypes.

[0031] As is discussed in published United States patent application US2002/0106705 (the entire disclosure of which is hereby incorporated by reference into this specification), the therapeutic agent that interacts with the tubulin isotype target may be, e.g., a ".beta.-tubulin modifying agent." One such agent is described in US2002/0106705 as being " . . . an agent that has the ability to specifically react with an amino acid residue of .beta.-tubulin, preferably a cysteine, more preferably the cysteine residue at position 239 of a .beta.-tubulin isotype such as .beta.1- .beta.2- or .beta.4-tubulin and antigenic fragments thereof comprising the residue, preferably cysteine 239. The .beta.-tubulin modifying agent of the invention can be, e.g., any sulfhydryl or disulfide modifying agent known to those of skill in the art that has the ability to react with the sulfur group on a cysteine residue, preferably cysteine residue 239 of a .beta.-tubulin isotype. Preferably, the .beta.-tubulin modifying agents are substituted benzene compounds, pentafluorobenzenesulfonamides, arylsulfonanilide phosphates, and derivatives, analogs, and substituted compounds thereof (see, e.g., U.S. Pat. No. 5,880,151; PCT 97/02926; PCT 97/12720; PCT 98/16781; PCT 99/13759; and PCT 99/16032, herein incorporated by reference; see also Pierce Catalogue, 1999/2000, and Means, Chemical Modification of Proteins). In one embodiment, the agent is 2-fluoro-1-methoxy-4-pentafluorophenylsulfonamidobenzene (compound 1; FIG. 1C). Modification of a .beta.-tubulin isotype at an amino acid residue, e.g., cysteine 239, by an agent can be tested by treating a .beta.-tubulin peptide, described herein, with the putative agent, followed by, e.g., elemental analysis for a halogen, e.g., fluorine, reverse phase HPLC, NMR, or sequencing and HPLC mass spectrometry. Optionally compound 1 described herein can be used as a positive control. Similarly, an .alpha.-tubulin modifying agent refers to an agent having the ability to specifically modify an amino acid residue of an .alpha.-tubulin." In one embodiment of this invention, prior art beta-tubulin targeting agents are modified by making them water-soluble and/or magnetic in accordance with the process of this invention.

Identification of the Tubulin Isotype Targets

[0032] The tubulin isotypes that are potential chemotherapeutic targets are preferably those isotypes that are present in a higher concentration in diseased biological organisms than in normal biological organisms. They may be identified by, e.g., standard analytical techniques.

[0033] By way of illustration, and not limitation, an analysis may be done regarding the extent to which, if any, a beta-tubulin isotype, e.g., is present in tumors. As is described in the Yeh et al. paper cited elsewhere in this specification, one may study a variety of tumors by "standard immunohistochemical techniques" to determine the extent to which one or more tubulin isotypes if present in the tumors. Yeh et al. state that: "Tumors were randomly selected from the San Antonio Cancer Institute Tumor Bank to represent a variety of tumor types, grades, and stages. Benign tissues adjacent to the tumor were examined when possible. In addition to malignant tumors, selected benign lesions, such as meningiomas, and tumors of low malignant potential, such as giant cell tumors of bone, were also examined. All tissues were formalin-fixed and paraffin-embedded . . . . Standard immunohistochemical techniques were utilized [Hsu et al., 1981]. The monoclonal antibody to the (BII isotype of tubulin (JDR.3B8) was at an initial concentration of 2 mg/mL and diluted 1:2,000, for a final concentration of 1 .mu.g/mL. No antigen retrieval step was used because the antigen was easily accessible for immunohistochemical staining. Slides were incubated at room temperature with the primary antibody for 1 h. The sections were then exposed to a secondary biotinylated rabbit anti-mouse antibody (DAKO, cat no. E354, 1:100), then Streptavidin horseradish peroxidase was applied, followed by diaminobenzidine and OsO.sub.4. Slides were counter-stained with methyl green. A positive skin control and negative controls (minus antibody) were run with each batch of tumors . . . . Slides were visualized using an Olympus BX-40 microscope, equipped with PlanFluorite objectives. The pattern and location of cells staining with the antibody to B11-tubulin were recorded. Intensity and proportion of cells stained were recorded in a semi-quantitative manner, as previously described [Allred et al., 1998]. . . ."

Preparation of a Database of Tubulin Isotypes

[0034] In one embodiment of the process of this invention, a database of tubulin isotypes is prepared. In this section of the specification, excerpts from a paper that was prepared by one of the applicants is presented. The paper in question is entitled "Homology Modeling of Tubulin Isotypes and its Consequences for the Biophysical Properties of Tubulin and Microtubules." One of the authors of this paper is applicant Jack .A. Tuszynski; and such paper will hereinafter be referred to as the "Tuszynski paper."

[0035] As is disclosed in the introductiory portion of the Tuszynski et al. paper, "Microtubules, cylindrical organelles found in all eukaryotes, are critically involved in a variety of cellular processes including motility, transport and mitosis." As authority for this proposition, the paper cites a text by J. S. Hymans et al. entitled "Microtubules" (Wiley-Liss, New York, N.Y., 1994).

[0036] The Tuszynski paper also discloses that: "Their component protein, tubulin, is composed of two polypeptides of related sequence, designated .alpha. and .beta.. In addition to .alpha.- and .beta.-tubulin, many microtubules in cells require the related .gamma.-tubulin for nucleation." As authority for this proposition, there are cited articles by H. P. Erickson (".gamma.-tubulin nucleation, template or protofilament?," Nature Cell Biology 2:E93-E96, 200) and by R. F. Luduena ("The multiple forms of tubulin: different gene products and covalent modifications," Int. Rev. Cytol. 178:207-275, 1998).

[0037] The Tuszynski paper also discloses that: "Two other tubulins, designated .delta. and .epsilon., are widespread, . . . although their roles are still uncertain . . . models utilizing them have been proposed." As authority for this statement, the paper cites works by S. T. Vaughan et al. ("New tubulins in protozoal parasites," Curr. Biol. 10:R258-R259, 2000) and Y. F. Inclan et al. ("Structural models for the self-assembly and microtubule interactions of . . . tubulin," Journal of Cell Science 114:413-422, 2001).

[0038] The Tuszynski paper also discloses that: "At least three of these tubulins, namely, .alpha., .beta., and .gamma., exist in many organisms as families of closely related isotypes. An enigmatic feature of tubulin is its heterogeneity. Not only can .alpha. and .beta.-tubulin exist as multiple isotypes in many organisms, but the protein can also undergo various post-translational modifications, such as phosphorylation, acetylation, detyrosination, and polyglutamylation." As authority for this statement, the paper cites a work by A. Banergee, "Coordination of posttranslational modificatioins of bovine brain, .alpha. tubulin, polyglycylation of delta2 tubulin," Journal of Biological Chemistry 277:46140-46144, 2002).

[0039] The Tuszynski paper also discloses that "At the molecular level tubulin's roles are highly complex and are related to the structural variations observed." As authority for this proposition, the article cites a work by K. L. Richards et al., "Structure-function relationships in yeast tubulins," Molecular Biology of the Cell 11:1887-1903, 2000.

[0040] The Tuszynski paper also states that " . . . microtubules undergo cycles of rapid growth and disassembly in a process known as dynamic instability that appears to be critical for microtubule function, especially in mitosis. A guanosine triphosphate (GTP) tubulin hydrolyzes bound GTP to GDP; the kinetics of this process in beta-tubulin is critical in regulating dynamic instability by affecting the loss of a so-called `cap` that stabilizes the microtubule structure." As authority for this statement, the article cites a work by T. J. Mitchison et al., "Dynamic instability of microtubule growth," Nature 312:237-242, 1984.

[0041] The Tuszynski paper also discloses that "In addition to forming microtubules, tubulin interacts with a large number of associated proteins. Some of these, such as tektin, may play structural roles; others, the so-called microtubule-associated proteins (MAPs) such as tau or MAP2, may stabilize the microtubules, stimulate microtubule assembly and mediate interactions with other proteins. Still others, such as kinesin and dynein, are motor proteins that move cargoes, e.g., vesicles, along microtubules." As authority for these statements, the article refers to works by M. Kikkawa et al. ("Switch-based mechanisms of kinesin motors," Nature 411:439-445, 2001) and Z., Wang et al. ("The C-terminus of tubulin increases cytoplasmic dynein and kinesin processity," Biophysical Journal 78:1955-1964, 2000).

[0042] As is also disclosed in the Tuszynski et al. paper, "The precise molecular basis of the properties of tubulin is still not well understood, in part because tubulin's highly flexible conformation . . . makes it difficult to crystallize this region." As authority for this statement, the article cites a work by O. Keskin et al., "Relating molecular flexibility to function: a case study of tubulin," Biphysical Journal 83:663-680, 2002.

[0043] The Tuszynski paper also discloses that: "In a major advance in the field, the three-dimensional structure of bovine brain tubulin has been determined by electron crystallography resulting in atomic structures available in the The Protein Data Bank (Berman et al. [2000] as entries 1TUB Nogales et al. (1998) and 1JFF Lowe et al. (2000)." The Berman et al. reference is to an article by H. M. Berman et al. on "The protein data bank," Nucleic Acids Research 28:235-242, 2000. The Nogales et al. reference was to an article by E. Nogales et al. on the "Structure of the alpha/beta tubulin dimer by electron crystallography," Nature 393: 199-203, 1998. The Lowe et al. reference is to an article by J. Lowe et al. on the "Refined structure of alpha/beta-tubulin at 3.5 angstrom resolution," Journal of Molecular Biology 313:1045-1057 (2001).

[0044] The Tuszynski paper also discloses that "Once the three dimensional structure of a protein is known it is possible to use homology modeling to predict the structures of related forms of the protein with some degree of accuracy. We have applied these techniques to a series of 300 different tubulins, representing .alpha.- and .beta.-tubulins from animals, plants, fungi and protists, as well as several .gamma.-, .delta.- and .epsilon.-tubulins." It should be noted that such "homology modeling" is frequently referred to in the patent literature. Reference may be had, e.g., to U.S. Pat. Nos. 5,316,935; 5,486,802; 5,686,255; 5,738,998; 6,027,720; 6,080,549; 6,197,589; 6,356,845; 6,433,158; 6,451,986; 6,468,770; 6,548,477; 6,654,644; 6,654,667; 6.627,746; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0045] The Tuszynski paper also discloses that: "For all of the resulting tubulin structures, we have been able to estimate the magnitudes and orientations of their dipole moments, charge distributions and surface to volume ratios. The magnitudes and orientations of the tubulin dimers' dipose moments appear to play significant roles in microtubule assembly and stability."

[0046] The Tuszynski paper also discloses that "In addition, we have been able to generate plausible conformations for the C-terminal regions. Notably, the C-termini of alpha- and beta-tubulin were not resolved in the original crystallographic structures of tubulin due to their flexibility and possibly sample inhomgeneity." As support for this statement, the article cited a work by E. Nogales et al., "Structure of the alpha/beta tubulin dimmer by electron crystallography," Nature 393:199-203, 1998.

[0047] The Tuszynski paper also discloses that "The importance of these regions is highlighted by the fact that they are the site of most of tubulin's post-translational modifications, that they bind to MAPs and that differences among tubulin isotypes cluster here."

[0048] The Tuszynski paper discusses the materials and methods used to construct the tublin isotype database. In one embodiment of the process used in the Tuszynksi paper, the " . . . abundance of various homologous isotypes of tubulin, called alpha and beta (with additional indices labeling the isotypes) is correlated with the specific locations of the cells in which they are found. We have used the known amino-acid sequences in which the isotypes differ, in connection with the data of the Downing group for the known three-dimensional structure obtained by electron crystallography of bovine brain tubulin by Nogales et al., and applied these in molecular dynamics simulations in order to study the resulting differences in the biophysical and biochemical properties such as: volume, surface are, electric field distributions, binding sites, conformational changes, etc. Our structural experiments on purified abII, abIII and abIV tubulin dimers have produced strong evidence that their conformations differ. Using the Molecular Simulation International (MSI) Homology Software Module, we have constructed three-dimensional models of the abI, abII, abIII, abIV, abV, abVI and abVII dimers. This Downing structure was fitted to the amino acid sequences for porcine brain a- and b-tubulin, which, for the beta subunit, is largely bII. To generate models of the various dimers, the Homology software module is used to align the sequences of the various isotypes to the sequence of the Nogales et al structure, and the coordinates of the Nogales structure are mapped to the aligned beta isotype. Then energy minimization and molecular dynamic simulation is being used on the approximate result to refine a structural model of each of these dimers. Similar homology modeling approaches have been used to predict the structure of one protein from that of a closely related protein; such models have also been extensively used to design useful drugs. In constructing computational 3D models from all of the available sequences of tubulin isotypes we have exploited the high degree of sequence and structure conservation that is observed within tubulin isotypes and between the alpha and beta subunits by using software such as the experimental Modeller and tubulin crystallographic data as structural templates to produce 3D models containing chosen amino acid sequences."

[0049] In one embodiment of the Tuszynski process, the "Swiss-Prot database" was referred to. As is also disclosed in the Tuszynski paper, "As an initial step the Swiss-Prot database Release 40.2 of 8 Nov. 2002 . . . (available at http://www.expasy.org/sprot/]) was searched for tubulin amino acid sequences." The article referred to a work by B. Boekmann et al. ("The SWISS-PROT protein knowledgebase and its supplement TrEMBL," Nucl. Acids. Res. 31:365-370, 2003) for a reference relating to such "Swiss-Prot database." It should be noted that many United States patents refer to such Swiss-Prot database. Reference may be had, e.g., to U.S. Pat. Nos. 6,183,968; 6,207,397; 6,303,319; 6,372,897; 6,373,971 (method and apparatus for pattern discovery in protein sequences); U.S. Pat. Nos. 6,387,641; 6,631,322 (methods for using functional site descriptors and predicting protein function), U.S. Pat. No. 6,466,874 (Rosetta stone method for detecting protein function and protein-protein interactions from genome sequences), U.S. Pat. No. 6,470,277 (techniques for facilitating identification of candidate genes), U.S. Pat. No. 6,564,151 (assigning protein functions by comparative genome analysis protein phylogenetic profiles), and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0050] Referring again to the Tuszynksi paper, it is disclosed that: "A search using the keyword `tubulin` was manually filtered to separate actual tubulin sequences from those of other tubulin related proteins. This provided some 290 sequences, representing a wide range of species. Of these 27 are annotated as being fragmentary, leaving 263 complete tubulin monomier sequences. Of particular interest were the 15 human sequences obtained . . . ."

[0051] Referring again to the Tuszynksi paper, it is disclosed that: "Table 1 summarizes all of the tubulin sequences used in this study for quick reference and convenience. The table names the source organism, and for each . . . gives the name used in the databank. It is important to relate the biochemical data encapsulated by the amino acid sequence to the biologically relevant information presented in Table 1 in the form of the organism from which a given tubulin is derived."

[0052] In referring to such "Table 1," the Tuszynski paper states that: "Table 1. Tubulin sequences used in this study. The table names the source organism, and for each . . . gives the name used in the databank." TABLE-US-00001 File Name Name of Organism SEQ. NO. TBA1_ANEPH Anemia phyllitidis SEQ ID NO. 1 TBA1_ARATH Arabidopsis thaliana SEQ ID NO. 2 TBA1_CHICK Gallus gallus SEQ ID NO. 3 TBA1_CHLRE Chlamydomonas reinhardtii SEQ ID NO. 4 TBA1_DROME Drosophila melanogaster SEQ ID NO. 5 TBA1_ELEIN Eleusine indica SEQ ID NO. 6 TRA1_EMENI Emericella nidulans SEQ ID NO. 7 TBA1_ENTHI Entamoeba histolytica SEQ ID NO. 8 TBA1_HOMAM Homarus americanus SEQ ID NO. 9 TBA1_HORVU Hordeum vulgare SEQ ID NO. 10 TBA1_HUMAN Homo sapiens SEQ ID NO. 11 TBA1_MAIZE Zea mays SEQ ID NO. 12 TBA1_MOUSE Mus musculus SEQ ID NO. 13 TBA1_NEUCR Neurospora crassa SEQ ID NO. 14 TBA1_ORYSA Oryza sativa SEQ ID NO. 15 TBA1_PARLI Paracentrotus lividus SEQ ID NO. 16 TBA1_PEA Pisum sativus SEQ ID NO. 17 TBA1_PELFA Pelvetia fastigiata SEQ ID NO. 18 TBA1_PNECA Pneumocystis carinii SEQ ID NO. 19 TBA1_SCHPO Schizosaccharomyces pombe SEQ ID NO. 20 TBA1_STYLE Stylonichia lemnae SEQ ID NO. 21 TBA1_VOLCA Volvox carteri SEQ ID NO. 22 TBA1_YEAST Saccharomyces cerevisiae SEQ ID NO. 23 TBA2_ANEPH Anemia phyllitidis SEQ ID NO. 24 TBA2_ARATH Arabidopsis thaliana SEQ ID NO. 25 TBA2_CAEEL Caenorhabditis elegans SEQ ID NO. 26 TBA2_CHICK Gallus gallus SEQ ID NO. 27 TBA2_CHLRE Chlamydomonas reinhardtii SEQ ID NO. 28 TBA2_DROME Drosophila melanogaster SEQ ID NO. 29 TBA2_ELEIN Eleusine indica SEQ ID NO. 30 TBA2_EMENI Emericella nidulans SEQ ID NO. 31 TBA2_HOMAM Homarus americanus SEQ ID NO. 32 TBA2_HORVU Hordeum vulgare SEQ ID NO. 33 TBA2_HUMAN Homo sapiens SEQ ID NO. 34 TBA2_MAIZE Zea mays SEQ ID NO. 35 TBA2_MOUSE Mus musculus SEQ ID NO. 36 TBA2_NEUCR Neurospora crassa SEQ ID NO. 37 TBA2PATVU Patella vulgata SEQ ID NO. 38 TBA2_PELFA Pelvetia fastigiata SEQ ID NO. 39 TBA2_SCHPO Schizosaccharomyces pombe SEQ ID NO. 40 TBA2_STYLE Stylonichia lemnae SEQ ID NO. 41 TBA3_ARATH Arabidopsis thaliana SEQ ID NO. 42 TBA3_CHICK Gallus gallus SEQ ID NO. 43 TBA3_DROME Drosophila melanogaster SEQ ID NO. 44 TBA3_ELEIN Eleusine indica SEQ ID NO. 45 TBA3_HOMAM Homarus americanus SEQ ID NO. 46 TBA3_HORVU Hordeum vulgare SEQ ID NO. 47 TBA3_MAIZE Zea mays SEQ ID NO. 48 TBA3_MOUSE Mus musculus SEQ ID NO. 49 TBA3_YEAST Saccharomyces cerevisiae SEQ ID NO. 50 TBA4_CHICK Gallus gallus SEQ ID NO. 51 TBA4_DROME Drosophila melanogaster SEQ ID NO. 52 TBA4_HUMAN Homo sapiens SEQ ID NO. 53 TBA4_MAIZE Zea mays SEQ ID NO. 54 TBA5_CHICK Gallus gallus SEQ ID NO. 55 TBA5_MAIZE Zea mays SEQ ID NO. 56 TBA6_ARATH Arabidopsis thaliana SEQ ID NO. 57 TBA6_HUMAN Homo sapiens SEQ ID NO. 58 TBA6_MAIZE Zea mays SEQ ID NO. 59 TBA6_MOUSE Mus musculus SEQ ID NO. 60 TBA8_CAEEL Caenorhabditis elegans SEQ ID NO. 61 TBA8_CHICK Gallus gallus SEQ ID NO. 62 TBA8_HUMAN Homo sapiens SEQ ID NO. 63 TBA8_MOUSE Mus musculus SEQ ID NO. 64 TBA_AJECA Ajellomyces capsulatum SEQ ID NO. 65 TBAA_PNECA Pneumocystis carinii SEQ ID NO. 66 TBAA_SCHCO Schizophyllum commune SEQ ID NO. 67 TBA_AVESA Avena sativa SEQ ID NO. 68 TBA_BLEJA Blepharisma japonicus SEQ ID NO. 69 TBA_BOMMO Bombyx mori SEQ ID NO. 70 TBAB_SCHCO Schizophyllum commune SEQ ID NO. 71 TBA_CANAL Candida albicans SEQ ID NO. 72 TBA_CHLVU Chlorella vulgaris SEQ ID NO. 73 TBA_DICDI Dictyostelium discoideum SEQ ID NO. 74 TBAD_PHYPO Physarum polycephalum SEQ ID NO. 75 TBAE_PHYPO Physarum polycephalum SEQ ID NO. 76 TBA_EUGGR Euglena gracilis SEQ ID NO. 77 TBA_EUPOC Euplotes octocarinatus SEQ ID NO. 78 TBA_EUPVA Euplotes vannus SEQ ID NO. 79 TBA_HAECO Haemonchus contortus SEQ ID NO. 80 TBA_LEPSE Leptomonas seymouri SEQ ID NO. 81 TBA_LYTPI Lytechinus pictus SEQ ID NO. 82 TBA_MYCGR Mycosphaerella graminicola SEQ ID NO. 83 TBA_NAEGR Naegleria gruberi SEQ ID NO. 84 TBA_NOTVI Notophtalamus viridescens SEQ ID NO. 85 TBAN_PHYPO Physarum polycephalum SEQ ID NO. 86 TBA_OCTDO Octopus Dofleini SEQ ID NO. 87 TBA_OCTVU Lytechinus pictus SEQ ID NO. 88 TBA_ONCKE Onchorhynchus keta SEQ ID NO. 89 TBA_OXYGR Oxytricha granulifera SEQ ID NO. 90 TBA_PICAB Picia abies SEQ ID NO. 91 TBA_PIG Sus scrofa SEQ ID NO. 92 TBA_PLAFK Plasmodium falciparum SEQ ID NO. 93 TBA_PLAYO Plasmodium berghei yoelii SEQ ID NO. 94 TBA_PRUDU Prunus dulcis SEQ ID NO. 95 TBA_SORMA Sordaria macrospora SEQ ID NO. 96 TBA_TETPY Tetrahymena pyriformis SEQ ID NO. 97 TBA_TETTH Tetrahymena thermophila SEQ ID NO. 98 TBAT_ONCMY Onchorhynchus mykiss SEQ ID NO. 99 TBA_TORMA Torpedo marmorata SEQ ID NO. 100 TBA_TOXGO Taxoplasma gondii SEQ ID NO. 101 TBA_TRYBR Trypanosoma brucei SEQ ID NO. 102 TBA_TRYCR Trypanosoma cruzi SEQ ID NO. 103 TBA_WHEAT Triticum aestivum SEQ ID NO. 104 TBA_XENLA Xenopus laevis SEQ ID NO. 105 TBB1_ANEPH Anemia phyllitidis SEQ ID NO. 106 TBB1_ARATH Arabidopsis thaliana SEQ ID NO. 107 TBB1_AVESA Avena sativa SEQ ID NO. 108 TBB1_BRUPA Brugia pahangi SEQ ID NO. 109 TBB1_CHICK Gallus gallus SEQ ID NO. 110 TBB1_CHOCR Chondrus crispus SEQ ID NO. 111 TBB1_COLGL Glomerella cingulata SEQ ID NO. 112 TBB1_COLGR Glomerella graminicola SEQ ID NO. 113 TBB1_CYAPA Cyanaphora paradoxa SEQ ID NO. 114 TBB1_DAUCA Daucus carota SEQ ID NO. 115 TBB1_ELEIN Eleusine indica SEQ ID NO. 116 TBB1_EMENI Emericella nidulans SEQ ID NO. 117 TBB1_GADMO Gadus morhua SEQ ID NO. 118 TBB1_GEOCN Galactomyces geotrichum SEQ ID NO. 119 TBB1_HOMAM Homarus americanus SEQ ID NO. 120 TBB1_HUMAN Homo sapiens SEQ ID NO. 121 TBB1_LUPAL Lupinus albus SEQ ID NO. 122 TBB1_MAIZE Zea mays SEQ ID NO. 123 TBB1_MANSE Manduca sexta SEQ ID NO. 124 TBB1_NOTCO Notothenia coriiceps SEQ ID NO. 125 TBB1_ORYSA Oryza sativa SEQ ID NO. 126 TBB1_PARTE Paramecium tetraurelia SEQ ID NO. 127 TBB1_PEA Pisum sativus SEQ ID NO. 128 TBB1_PHYPO Physarum polycephalum SEQ ID NO. 129 TBB1_PORPU Porphyra purpura SEQ ID NO. 130 TBB1_RAT Rattus norvegicus SEQ ID NO. 131 TBB1_SOLTU Solanum tuberosum SEQ ID NO. 132 TBB1_SOYBN Glycine max SEQ ID NO. 133 TBB1_TRIVI Trichoderma viride SEQ ID NO. 134 TBB1_VOLCA Volvox carteri SEQ ID NO. 135 TBB1_WHEAT Triticum aestivum SEQ ID NO. 136 TBB2_ANEPH Anemia phyllitidis SEQ ID NO. 137 TBB2_ARATH Arabidopsis thaliana SEQ ID NO. 138 TBB2_CAEEL Caenorhabditis elegans SEQ ID NO. 139 TBB2_CHICK Gallus gallus SEQ ID NO. 140 TBB2_COLGL Glomerella cingulata SEQ ID NO. 141 TBB2_COLGR Glomerella graminicola SEQ ID NO. 142 TBB2DAUCA Daucus carota SEQ ID NO. 143 TBB2_DROER Drosophila erecta SEQ ID NO. 144 TBB2_DROME Drosophila melanogaster SEQ ID NO. 145 TBB2_ELEIN Eleusine indica SEQ ID NO. 146 TBB2_EMENI Emericella nidulans SEQ ID NO. 147 TBB2_ERYPI Erysiphe pisi SEQ ID NO. 148 TBB2_GEOCN Galactomyces geotrichum SEQ ID NO. 149 TBB2_HOMAM Homarus americanus SEQ ID NO. 150 TBB2_HUMAN Homo sapiens SEQ ID NO. 151 TBB2_LUPAL Solanum tuberosum SEQ ID NO. 152 TBB2_MAIZE Zea mays SEQ ID NO. 153 TBB2_ORYSA Oryza sativa SEQ ID NO. 154 TBB2_PEA Pisum sativus SEQ ID NO. 155 TBB2_PHYPO Physarum polycephalum SEQ ID NO. 156 TBB2_PORPU Porphyra purpura SEQ ID NO. 157 TBB2_SOLTU Solanum tuberosum SEQ ID NO. 158 TBB2_SOYBN Glycine max SEQ ID NO. 159 TBB2_TRIVI Trichoderma viride SEQ ID NO. 160 TBB2_WHEAT Triticum aestivum SEQ ID NO. 161 TBB2_XENLA Xenopus laevis SEQ ID NO. 162 TBB3_ANEPH Anemia phyllitidis SEQ ID NO. 163 TBB3_CHICK Gallus gallus SEQ ID NO. 164 TBB3_DROME Drosophila melanogaster SEQ ID NO. 165 TBB3_ELEIN Eleusine indica SEQ ID NO. 166 TBB3_MAIZE Zea mays SEQ ID NO. 167 TBB3_ORYSA Oyza sativa SEQ ID NO. 168 TBB3_PEA Pisum sativus SEQ ID NO. 169 TBB3_PORPU Porphyra purpura SEQ ID NO. 170 TBB3_SOYBN Glycine max SEQ ID NO. 171 TBB3_WHEAT Triticum aestivum SEQ ID NO. 172 TBB4_ARATH Arabidopsis thaliana SEQ ID NO. 173 TBB4_CAEEL Caenorhabditis elegans SEQ ID NO. 174 TBB4_CHICK Gallus gallus SEQ ID NO. 175 TBB4_ELEIN Eleusine indica SEQ ID NO. 176 TBB4_HUMAN Homo sapiens SEQ ID NO. 177 TBB4_MAIZE Zea mays SEQ ID NO. 178 TBB4_PORPU Porphyra purpura SEQ ID NO. 179 TBB4_WHEAT Triticum aestivum SEQ ID NO. 180 TBB4_XENLA Xenopus laevis SEQ ID NO. 181 TBB5_ARATH Arabidopsis thaliana SEQ ID NO. 182 TBB5_CHICK Gallus gallus SEQ ID NO. 183 TBB5_ECTVR Ectocarpus variabilis SEQ ID NO. 184 TBB5_HUMAN Homo sapiens SEQ ID NO. 185 TBB5_MAIZE Zea mays SEQ ID NO. 186 TBB5_WHEAT Triticum aestivum SEQ ID NO. 187 TBB6_ARATH Arabidopsis thaliana SEQ ID NO. 188 TBB6_CHICK Gallus gallus SEQ ID NO. 189 TBB6_ECTVR Ectocarpus variabilis SEQ ID NO. 190 TBB6_MAIZE Zea mays SEQ ID NO. 191 TBB7_ARATH Arabidopsis thaliana SEQ ID NO. 192 TBB7_CAEBR Caenorhabditis briggsae SEQ ID NO. 193 TBB7_CAEEL Caenorhabditis elegans SEQ ID NO. 194 TBB7_CHICK Gallus gallus SEQ ID NO. 195 TBB7_MAIZE Zea mays SEQ ID NO. 196 TBB8_ARATH Arabidopsis thaliana SEQ ID NO. 197 TBB8_MAIZE Zea mays SEQ ID NO. 198 TBB9_ARATH Arabidopsis thaliana SEQ ID NO. 199 TBB_ACHKL Achlya klebsiana SEQ ID NO. 200 TBB_ACRCO Neotyphodium coenophialum SEQ ID NO. 201 TBB_AJECA Ajellomyces capsulatum SEQ ID NO. 202 TBB_ASPFL Aspergillus flavus SEQ ID NO. 203 TBB_ASPPA Aspergillus parasiticus SEQ ID NO. 204 TBB_BABBO Babesia bovis SEQ ID NO. 205 TBB_BOMMO Bombyx mori SEQ ID NO. 206 TBB_BOTCI Botryotinia fuckeliana SEQ ID NO. 207 TBB_CANAL Candida albicans SEQ ID NO. 208 TBB_CEPAC Acremonium chrysogenum SEQ ID NO. 209 TBB_CHLIN Chlamydomonas incerta SEQ ID NO. 210 reinhardtii TBB_CHLRE Chlamydomonas reinhardtii SEQ ID NO. 211 TBB_CICAR Cicer arietinum SEQ ID NO. 212 TBB_DICDI Dictyostelium discoideum SEQ ID NO. 213 TBB_EIMTE Eimeria tenella SEQ ID NO. 214 TBB_EPITY Epichloe typhina SEQ ID NO. 215 TBB_ERYGR Blumeria graminis SEQ ID NO. 216 TBB_EUGGR Euglena gracilis SEQ ID NO. 217 TBB_EUPCR Monoeuplotes crassus SEQ ID NO. 218 TBB_EUPFO Euplotes focardii SEQ ID NO. 219 TBB_EUPOC Euplotes octocarinatus SEQ ID NO. 220 TBB_GIALA Giardia intestinalis SEQ ID NO. 221 TBB_GIBFU Gibberella fujikuroi SEQ ID NO. 222 TBB_HALDI Haliotis discus SEQ ID NO. 223 TBB_HORVU Hordeum vulgare SEQ ID NO. 224 TBB_LEIME Leishmania mexicana SEQ ID NO. 225 TBB_LYMST Lymnae stagnalis SEQ ID NO. 226 TBB_LYTPI Lytechinus pictus SEQ ID NO. 227 TBB_MYCPJ Mycosphaerella pini SEQ ID NO. 228 TBB_NAEGR Naegleria gruberi SEQ ID NO. 229 TBB_NEUCR Neurospora crassa SEQ ID NO. 230 TBB_OCTDO Octopus Dofleini SEQ ID NO. 231 TBB_ONCGI Onchocerca gibsoni SEQ ID NO. 232 TBB_PARLI Paracentrotus lividus SEQ ID NO. 233 TBB_PENDI Penicillium digitatum SEQ ID NO. 234 TBB_PESMI Pestalotiopsis microspora SEQ ID NO. 235 TBB_PHANO Phaeosphaeria nodorum SEQ ID NO. 236 TBB_PHYCI Phytophthora cinnamomi SEQ ID NO. 237 TBB_PIG Sus scrofa SEQ ID NO. 238 TBB_PLAFA Plasmodium falciparum SEQ ID NO. 239 TBB_PLAFK Plasmodium falciparum SEQ ID NO. 240 TBB_PLESA Pleurotus sajor-caju SEQ ID NO. 241 TBB_PNECA Pneumocystis carinii SEQ ID NO. 242

TBB_POLAG Polytomella agilis SEQ ID NO. 243 TBB_PSEAM Pseudopleuronectes americanus SEQ ID NO. 244 TBBQ_HUMAN Homo sapiens SEQ ID NO. 245 TBB_RHYSE Rhynchosporium secalis SEQ ID NO. 246 TBB_SCHCO Schizophyllum commune SEQ ID NO. 247 TBB_SCHPO Schizosaccharomyces pombe SEQ ID NO. 248 TBB_STRPU Strongylocentrotus purpuratus SEQ ID NO. 249 TBB_STYLE Stylonichia lemnae SEQ ID NO. 250 TBB_TETPY Tetrahymena pyriformis SEQ ID NO. 251 TBB_TETTH Tetrahymena thermophila SEQ ID NO. 252 TBB_THAWE Thalassiosira weisflogii SEQ ID NO. 253 TBB_TOXGO Taxoplasma gondii SEQ ID NO. 254 TBB_TRYBR Trypanosoma brucei SEQ ID NO. 255 TBB_TRYCR Trypanosoma cruzi SEQ ID NO. 256 TBB_VENIN Venturia inaequalis SEQ ID NO. 257 TBBX_HUMAN Homo sapiens SEQ ID NO. 258 TBB_YEAST Saccharomyces cerevisiae SEQ ID NO. 259 TBD_HUMAN Homo sapiens SEQ ID NO. 260 TBE_HUMAN Homo sapiens SEQ ID NO. 261 TBG1_HUMAN Homo sapiens SEQ ID NO. 262 TBG1_MAIZE Zea mays SEQ ID NO. 263 TBG1_MOUSE Mus musculus SEQ ID NO. 264 TBG2_ARATH Arabidopsis thaliana SEQ ID NO. 265 TBG2_DROME Drosophila melanogaster SEQ ID NO. 266 TBG2_EUPCR Monoeuplotes crassus SEQ ID NO. 267 TBG2_EUPOC Euplotes octocarinatus SEQ ID NO. 268 TBG2_HUMAN Homo sapiens SEQ ID NO. 269 TBG2_MAIZE Zea mays SEQ ID NO. 270 TBG2_MOUSE Mus musculus SEQ ID NO. 271 TBG2_ORYSA Oryza sativa SEQ ID NO. 272 TBG3_MAIZE Zea mays SEQ ID NO. 273 TBG_ANEPH Anemia phyllitidis SEQ ID NO. 274 TBG_CAEEL Caenorhabditis elegans SEQ ID NO. 275 TBG_CANAL Candida albicans SEQ ID NO. 276 TBG_CHLRE Chlamydomonas reinhardtii SEQ ID NO. 277 TBG_COCHE Cochiloboius heterostrophus SEQ ID NO. 278 TBG_EMENI Emericella nidulans SEQ ID NO. 279 TBG_ENTHI Entamoeba histolytica SEQ ID NO. 280 TBG_EUPAE Euplotes aediculatus SEQ ID NO. 281 TBG_NEUCR Neurospora crassa SEQ ID NO. 282 TBG_PHYPA Physcomitrella patens SEQ ID NO. 283 TBG_PLAFO Plasmodium falciparum SEQ ID NO. 284 TBG_RETFI Reticulomyxa filosa SEQ ID NO. 285 TBG_SCHJP Schizosaccharomyces japonicus SEQ ID NO. 286 TBG_SCHPO Schizosaccharomyces pombe SEQ ID NO. 287 TBG_USTVI Microbotryum violaceum SEQ ID NO. 288 TBG_XENLA Xenopus laevis SEQ ID NO. 289 TBG_YEAST Saccharomyces cerevisiae SEQ ID NO. 290

[0053] Referring again to the Tuszynksi paper, and in referring to "Model Construction." the paper disclosed that: "The structures of alpha and beta tubulins are known to be quite similar, being nearly indistinguishable at 6 Angstroms . . . dispite only a 40% amino acid homology." As support for this statement, reference is made to an article by H. Li et al., "Microtubule structure at 8 angstrom resolution," Structure 10:1317-1328, 2002."

[0054] Referring again to the Tuszynksi paper, it is disclosed that: " . . . Since the sequences within an alpha or beta tubulin family are more similar to each other than to those sequences belonging to the other families of tubuins, it is reasonable to believe that any given sequence should produce a structure very similar to another member of a given family. Further support for this comes from the published structures of Nogales et al. (1998) and Lowe et al. (2001) which are of a porcine sequence, but which were fit to data from an inhomogeneous bovine sample." The Nogales et al. reference is to an article by E. Nogales et al., "Structure of the alpha/beta tubulin dimmer by electron crystallogaraphy," Nature 393: 199-303. The Lowe et al. reference was to an article by J. Lowe et al., "Refined structure of alpha/betal tubulin at 3.5 angstrom resolution," Journal of Molecular Biology 313:1045-1057 (2001).

[0055] Referring again to the Tuszynksi paper, it is disclosed that: "Accordingly, by substituting appropriate amino acid side chains and properly adjusting other residues to accommodate insertions and deletions and in the sequence, crystallographic structures can be used as a framework to produce model structures with different sequences with a high degree of confidence."

[0056] As is also disclosed in the Tuszynski et al. paper, "To build such 3D structures of the many isotypes Modeller (version 6.2) was used [Marti-Renom 2000]." The Marti-Renom reference is an article by M. A. Marti-Renom et al., "Comparative protein structure modeling of genes and genomes," Annu. Rev. Biophys. Biomol. Struct. 29:291-325, 2000.

[0057] In the Marti-Renom paper, it is stated that the MODELLER database is disclosed at "guitar.Rockefeller.edu/modeler.html" and is discussed in an article by A. Sali et al., "Comparative protein modeling by satisfaction of spatial restraints," J. Mol. Biol. 234:799-915, 1993.

[0058] The Modeller database is also referred to in the patent literature. Reference may be had, e.g., to U.S. Pat. Nos. 5,859,972; 5,968,782; 5,985,643; 6,225,446; 6,251,620 (three dimensional structure of a ZAP tyrosine protein kinase fragement and modeling methods), U.S. Pat. Nos. 6,391,614; 6,417,324; 6,459,996; 6,468,772; 6,495,354; 6,495,674; 6,532,437; 6,559,297; 6,605,449; 6,642,041; 6,607,902; 6,645,762; 6,569,656; 6,677,377 (structure based discovery of inhibitors of matriptase for the treatement of cancer and other conditions), U.S. Pat. No. 6,680,176; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0059] The Modeller database may be used for the "comparative protein structure modeling" that is discussed in, e.g., the Marti-Renom paper (and also in the Tuszynski paper). Such "comparative protein structure modeling" is also referred to in the patent literature. Reference may be had, e.g., to U.S. Pat. Nos. 6,462,189; 6,703,199; and 6,703,901; reference may also be had to published United States patent applications 2002/0045578 and 2004/0014944 (method and system useful for structural classification of unknown polypeptides); and reference also may be had to international patent publications WO0135255 (large scale comparative protein structure modeling); WO0234877; WO03019183(process for the informative and iterative design of a gene-family screening library), and WO03029404. The entire disclosure of each of these United States patents, of each of these published United States patent applications, and of each of these international patent applications, is hereby incorporated in its entirety into this specification.

[0060] Referring again to the Tuszynksi paper, and to the Modeller program used therein, it is disclosed that: "To build the library of 3D tubulin structures, Modeller (version 6v2) was used . . . . This program uses alignment of the sequences with known related structures, used as templates, to obtain spatial constraints that the output structure must satisfy. Additional restraints derived from statistical studies of representative protein and chemical structures are also used to ensure a physically probable result. Missing loop regions are predicuted by simulated annealing optimization of a molecular mechanics model."

[0061] As is known to those skilled in the art, a system as large as tubulin may have many local energy minima; thus, an energy minimization program may not be sufficient to find the lowest global minimum. To seek the difference in conformation between GTP (guanosine triphosphate) and GDP (guanosine diphosphate) tubulin, applicants preferably use an annealing procedure in which the molecule is heated up well beyond physiological temperatures to induce a difference in conformation and is then slowly cooled down below physiological temperatures. The cooling process is maintained at a low enough rate so that the molecule can move between minima and find a lower energy final conformation. For a similar process that is applied by kinesin, reference may be had, e.g., to an article by W. Wriggers et al. on "Nucleotide-dependent movements of the kinesis motor domain predicted by simulated annealing," Biophys. J., 75:646-661, August, 1998.

[0062] In one embodiment of the process of this invention, the TINKER molecular simulation software is used. This software package is described, e.g., in an article by M. J. Dudek et al. on the "Accurate modeling of the intramolecular electrostatic energy of proteins," J. Comput. Chem, 16:791-816, 1995. This TINKER software is also described in, e.g., U.S. Pat. Nos. 5,049,390; 6,180,612; 6,531,306; 6,537,791; and 6,573,060. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0063] In one embodiment, the TINKER anneal program is preferably used to heat up the proteins from 1 degree Kelvin to 400 degrees Kelvin and then cool them very slowly to 200 degrees Kelvin.

[0064] In one embodiment, the anneal program is used to heat up the proteins from a temperature of from about 1 to about 299 degrees Kelvin to a temperature within the range of from about 300 to about 500 degrees Kelvin linearly over a period of from about 100 to about 100,000 picoseconds, preferably, overa period of at least about 200 picoseconds.

[0065] Referring again to the Tuszynksi paper, it is disclosed therein that "Since the 3D structures of tubulin lack the extreme C-termini of the proteins, we used this capability to create structure files that include the C-terminal amino acids by including those portions of the sequence in the Modeller input." In the process of this invention, the tubulin with its C-terminii, "tubulin-C," may be generated by adding the missing residues onto the alpha band beta-tubulin. Thus, e.g., one may use the "MOLMOL" software to add the "missing residues." See, e.g., an article by R. Koradi, "MOLMOL: a program for display and analysis of macromolecular structures," J. Mol. Graphics, 14:51-55, 1996. Reference also may be had, e.g., to U.S. Pat. No. 6,077,682 (method of identifying inhibitors of sensor histidine kinases through rational drug design); U.S. Pat. Nos. 6,162,627; 6,171,804 (method of determining interdomain orientation and changes of interdomain orientation on ligaton), U.S. Pat. No. 6,723,697; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0066] In the process described in the Tuszynski paper, the missing residues were added by the Modeller software, and the "tubulin-C model" was then subjected to an energy minimization program. As is known to those skilled in the art, in an energy minimization program, one searches for the minimum energy configuration of a molecule by moving down a gradient through configuration space (see W. F. van Gusteren et al., "Computer simulation of molecular dynamics: Methodoly, applications and perspectives in chemistry," Angew. Chem. Int. Ed. Engl., 29-992-1023, 1990. Reference also may be had, e.g., to U.S. Pat. No. 5,453,937 (method and system for protein modeling); U.S. Pat. No. 5,557,535 (method and system for protein modeling); U.S. Pat. No. 5,884,230 (method and system for protein modeling); U.S. Pat. No. 6,188,965 (apparatus and method for automated protein design); U.S. Pat. No. 6,269,312 (apparatus ad method for automated protein design); U.S. Pat. Nos. 6,376,504; 6,380,190; 6,403,312 (protein design authoamtic for protein libraries); U.S. Pat. Nos. 6,514,729; 6,545,152; 6,682,923; 6,689,793; 6,708,120 (apparatus and method for automated protein design); U.S. Pat. Nos. 6,746,853; 6,750,325; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0067] Referring again to the Tuszynski paper, it is disclosed that: "For our work we used five structures from the tubulin family as templates. One of these from PDB file 1FSZ (Lowe and Amos, 1998) is the crystal structure of FtsZ, a putative prokaryontic homolog of tublin Erickson (1997)." The Lowe and Amos reference is an article by J. Lowe et al., "Crystal Structure of the bacterial cell-division protein FtsZ," Nature, 393:203-206, 1998. The Erickson reference is an article by H. P. Erickson, "FtsZ, a tubulin homologue, in prokaryote cell division," Trends Cell Biol., 7:362-367, 1997. Reference also may be had, e.g., to U.S. Pat. No. 6,350,866, the entire disclosure of which is hereby incorporated by reference in to this specification.

[0068] Another two of the tubulin templates described in the Tuszynski paper were described as being "Two more structures (and alpha- and a beta-monomer) came from 1TUB (Nogales et al., 1998), the original tubulin crystal . . . ." The Nogales et al. reference is E. S. Nogales et al., "Structure of the alpha/beta tubulion dimmer by electron crystallography," Nature 393:199-203, 1998.

[0069] Yet another two of the tubulin templates described in the Tuszynski paper were " . . . two more from 1JFF (Lowe et al. 2001), a more refined version of the same structure." The Lowe et al. reference is an article by J. H. Lowe et al. on "Refined structure of alpha/beta tubulin at 3.5 angstrom resolution," Journal of Molecular Biology, 313:1045-1057, 2001.

[0070] As is also disclosed in the Tuszynski et al. paper, "With the resulting library of structural tubulin models, various computational estimates of physical properties of the different tubulins may be made. These include the volume, surface area, net charge, and dipole moments. We performed these calculations on the model structures, typically using analysis tools within the Gromacs (Lindahl et al., 2001) molecular dynamics package (version 3.1.4) . . . ." The Lindahl et al. reference was an article by E. B. Lindahl et al. entitled "GROMACS 3.0: A package for molecular simulation and trajectory analysis," J. Mol. Mod., 7:306-317, 2001. Reference also may be had, e.g., to published United States patent applications 2003/0082521, 2003/0108957, 2003/0187626 (method for providing thermal excitation to molecular dynamics models), and 2003/0229456 (methods for pedicting properties of molecules). The entire disclosure of each of these published patent applications is hereby incorporated by reference into this specification.

[0071] As is also disclosed in the Tuszynski article, "We also analyzed the properties of the C-terminal projection. We first needed to define this region. We used Clustal W (version 1.82) (Thompson et al., 1994) in order to obtain a multiple sequence alignment amongst the peptides. The multiple alignment then allows rapid identification of corresponding residues in all of the sequences." The Thompson et al. reference is an article by J. D. Thompson et al. on "CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice," Nucleic Acids Research, 22:4673-4680, 1994. Reference also may be had, e.g., to U.S. Pat. Nos. 6,403,558; 6,451,548; 6,465,431; 6,489,537; 6,559,294; 6,582,950; 6,632,621; 6,653,283; 6,586,401; 6,589,936; 6,734,283; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0072] As is also disclosed in the Tuszynski paper, "Other interesting properties of tubulin are inherent to dimers. In order to create a set of dimers for study we fit an alpha-monomer and a beta-monomer to their corresponding monomers in the 1JFF structure. This was done by rotation and translation of the Modeller structures in order to minimize the RMSD between a set of alpha-carbons from residues present in all the sequences. This procedure does notprevent steric conflicts between the two monomers and can create dimers with overlaps. However, for some types of calculations such as estimates of multipiole components, this will not prevent reasonable results. A set of over 200 dimers was obtained in this way by constructing all the alpha--beta pairs that share a common species identifier in the Swiss-Prot name. This restricts the number of dimers to a manageable set and voids hybrids such as a carrot/chicken crossing that would not occur naturally."

[0073] As is also disclosed in the Tuszynski paper, "The library of tubulin structures . . . were analyzed by molecular mechanics to determine their net charges, dipole moment components, dipole orientations, volumes, surface areas and the lengths and charges of their C-termini. The results of our computatations in this regard are shown in Table 2." The Table 1 below contains the data presented in the Table 2 of the article. TABLE-US-00002 TABLE 1 TABLE 1 Net Volume Name <M_x> <M_y> <M_z> <IMI> Chg A{circumflex over ( )}3 Area A{circumflex over ( )}2 TBA1_ANEPH -3.02E+02 -6.06E+02 1.16E+03 1.34E+03 -22 43722.51 46119.66 TBA1_ARATH 5.03E+01 -4.69E+02 1.50E+03 1.57E+03 -24 43725.6 46097.33 TBA1_CHICK -2.84E+02 -9.75E+02 1.61E+003 1.90E+03 -21 40489.52 43082.05 F TBA1_CHLRE -6.10E+01 -7.44E+02 7.28E+02 1.04E+03 -21 43642.98 45933.57 TBA1_DROME 5.95E+01 -6.29E+02 1.05E+03 1.23E+03 -22 44030.65 46824.19 TBA1_ELEIN -5.54E+01 -3.29E+02 1.37E+03 1.41E+003 -24 43860.52 46749.02 TBA1_EMENI -1.86E+02 -1.23E+03 7.71E+002 1.47E+03 -24 44069.69 46434.2 TBA1_ENTHI 2.50E+02 -6.70E+02 1.46E+02 7.30E+02 -10 44061.3 46460.88 TBA1_HOMAM -1.53E+02 -1.15E+03 9.52E+02 1.50E+03 -22 44167.33 46824.48 TBA1_HORVU 1.55E+02 -3.40E+02 1.27E+03 1.32E+03 -23 43590.96 45826.84 TBA1_HUMAN -4.67E+02 -8.10E+02 1.11E+03 1.45E+03 -24 44250.31 47173.96 TBA1_MAIZE 1.03E+02 -3.28E+02 1.28E+03 1.32E+03 -24 43834.72 46651.62 TBA1_MOUSE -3.33E+02 -1.21E+03 7.70E+02 1.47E+03 -24 44263.22 47101.9 TBA1_NEUCR 4.87E+01 -6.76E+02 6.94E+02 9.70E+02 -19 44052.23 46358.29 TBA1_ORYSA -2.19E+02 -1.16E+03 1.12E+03 1.62E+03 -24 43648.39 45939.87 TBA1_PARLI 2.71E+002 -1.19E+03 1.78E+03 2.16E+03 -25 44183.57 46803.97 TBA1_PEA -3.23E+02 -7.69E+02 1.05E+03 1.34E+03 -23 43567.64 45723.58 TBA1_PELFA -4.01E+002 -1.41E+003 8.27E+002 1.68E+003 -24 43906.79 46567.68 TBA1_PNECA -2.57E+001 -9.24E+002 9.87E+002 1.35E+003 -20 44334.85 47012.18 TBA1_SCHPO -2.56E+000 -1.26E+003 6.43E+002 1.41E+003 -22 44895.34 47968.48 TBA1_STYLE -2.03E+002 -1.27E+003 8.29E+002 1.53E+003 -23 43243.03 45451.26 TBA1_VOLCA -1.26E+002 -8.00E+002 6.88E+002 1.06E+003 -21 43630.21 45981.34 TBA1_YEAST -1.90E+002 -9.79E+002 4.23E+002 1.08E+003 -22 43873.76 46461.59 TBA2_ANEPH -2.78E+002 -8.85E+002 1.35E+003 1.64E+003 -15 35461.49 37487.42 F TBA2_ARATH -1.18E+002 -6.40E+002 1.50E+003 1.63E+003 -23 43766.11 46803.45 TBA2_CAEEL -1.39E+002 -8.51E+002 1.07E+003 1.37E+003 -22 43890.89 46319.2 TBA2_CHICK -9.83E+001 -2.00E+002 1.12E+003 1.14E+003 -25 43774.22 46365.41 TBA2_CHLRE -1.41E+002 -8.09E+002 7.99E+002 1.15E+003 -22 43601.27 45660.58 TBA2_DROME -9.25E+001 -1.09E+003 7.03E+002 1.30E+003 -21 44116.52 46892.4 TBA2_ELEIN 3.81E+001 -3.80E+002 1.39E+003 1.44E+003 -21 43843.11 45940.56 TBA2_EM EN I -3.11E+002 -1.41E+003 6.14E+002 1.57E+003 -21 44173.08 46890.29 TBA2_HOMAM -7.38E+002 -6.68E+002 9.66E+002 1.39E+003 -20 44252.35 47078.27 TBA2_HORVU -1.24E+002 -5.45E+002 1.44E+003 1.54E+003 -24 43705.55 46254.23 TBA2_HUMAN -7.89E+001 -1.27E+003 7.92E+002 1.49E+003 -23 44045.61 46631.11 TBA2_MAIZE 3.87E+001 -3.08E+002 1.32E+003 1.35E+003 -24 43670.06 46059.53 TBA2_MOUSE -4.62E+002 -1.26E+003 7.32E+002 1.53E+003 -24 44188.6 46902.07 TBA2_NEUCR -4.64E+002 -8.59E+002 6.78E+002 1.19E+003 -22 43969.77 46397.94 TBA2PATVU -7.08E+002 -1.23E+003 9.86E+002 1.73E+003 -24 44205.67 46802.41 TBA2_PELFA -5.63E+002 -1.35E+003 1.09E+003 1.82E+003 -25 43972.36 46729.96 TBA2_SCHPO -3.69E+002 -6.06E+002 7.84E+002 1.06E+003 -23 44413.68 47084.43 TBA2_STYLE -1.52E+002 -1.20E+003 1.42E+003 1.87E+003 -21 43462.96 45794.68 TBA3_ARATH -1.37E+002 -6.23E+002 1.31E+003 1.45E+003 -23 43767.64 46340.56 TBA3_CHICK 9.52E+001 -1.35E+003 4.35E+002 1.42E+003 -11 31862.21 34076.89 F TBA3_DROME 8.39E+001 -5.89E+002 9.56E+002 1.13E+003 -22 44025.38 46744.36 TBA3_ELEIN -2.23E+002 -1.06E+003 7.94E+002 1.34E+003 -24 43622.68 45927.05 TBA3_HOMAM -4.66E+002 -1.35E+003 9.96E+002 1.74E+003 -24 44023.88 46424.8 TBA3_HORVU 1.67E+002 -2.61E+002 1.19E+003 1.23E+003 -24 43774.25 46614.74 TBA3_MAIZE -2.26E+002 -9.73E+002 1.25E+003 1.60E+003 -20 43523.21 45861.11 TBA3_MOUSE -7.89E+001 -1.27E+003 7.92E+002 1.49E+003 -23 44045.61 46631.11 TBA3_YEAST -3.29E+001 -1.38E+003 7.81E+001 1.38E+003 -20 43772.88 46394.31 TBA4_CHICK -7.55E+001 -1.23E+003 1.34E+003 1.82E+003 -19 31763.1 34085.01 F TBA4_DROME -4.56E+002 -9.92E+002 8.14E+002 1.36E+003 -18 44749.62 46802.21 TBA4_HUMAN -4.56E+001 -7.37E+002 1.29E+003 1.49E+003 -24 44006.12 46802.17 TBA4_MAIZE 1.91E+002 5.47E+002 5.31E+002 7.86E+002 -13 5653.1 6441.79 F TBA5_CHICK -5.61E+002 -8.51E+002 9.93E+002 1.42E+003 -24 44001.41 46787.46 TBA5_MAIZE 1.18E+002 -3.59E+002 1.20E+003 1.26E+003 -24 43664.32 46180.91 TBA6_ARATH -4.74E+002 -9.38E+002 1.03E+003 1.47E+003 -23 43549.12 45981.06 TBA6_HUMAN -1.51E+002 -8.12E+002 9.12E+002 1.23E+003 -23 44019.72 46935.74 TBA6_MAIZE 1.05E+002 -2.29E+002 1.28E+003 1.30E+003 -24 43616.26 45962.24 TBA6_MOUSE -4.97E+002 -8.04E+002 8.36E+002 1.26E+003 -23 44005.43 46878.15 TBA8_CAEEL 4.38E+001 -1.35E+003 6.07E+002 1.48E+003 -21 44092.19 46452.13 TBA8_CHICK -3.14E+002 -1.21E+003 6.74E+002 1.42E+003 -17 31941.5 34147.91 F TBA8_HUMAN -2.56E+002 -1.13E+003 6.47E+002 1.33E+003 -24 44108.74 46846.78 TBA8_MOUSE 2.58E+001 -9.76E+002 5.25E+002 1.11E+003 -23 44094.24 46772.18 TBA_AJECA 4.11E+002 -5.71E+002 -3.80E+002 8.00E+002 -11 40915.67 42810.21 F TBAA_PNECA 4.02E+002 -4.58E+002 -3.47E+002 7.01E+002 0 21163.74 22925.51 F TBAA_SCHCO 6.78E+000 -9.52E+002 6.63E+002 1.16E+003 -20 43528.88 46457.95 TBA_AVESA 4.40E+002 -3.62E+002 3.57E+002 6.72E+002 -17 43193.08 45318.02 TBA_BLEJA -1.14E+002 4.91E+001 5.37E+001 1.35E+002 -17 4939.05 5726.72 F TBA_BOMMO -1.56E+002 -1.02E+003 5.91E+002 1.19E+003 -23 44002.66 46587.95 TBAB_SCHCO 1.68E+002 -8.87E+002 1.06E+003 1.39E+003 -17 43480.44 46447.1 TBA_CANAL -2.94E+002 -1.58E+003 1.45E+002 1.61E+003 -20 43827.47 46383.14 TBA_CHLVU -3.40E+002 -1.04E+003 6.60E+002 1.28E+003 -23 43800.27 46511.59 TBA_DICDI -2.65E+002 -8.18E+002 4.88E+002 9.88E+002 -15 44897.67 47487.03 TBAD_PHYPO 7.24E+001 -8.54E+002 1.25E+003 1.51E+003 -22 43832.96 46203.15 TBAE_PHYPO 5.38E+001 -8.04E+002 9.48E+002 1.24E+003 -22 43712.79 46164.96 TBA_EUGGR -5.50E+002 -9.02E+002 7.55E+002 1.30E+003 -23 44007.88 46521.52 TBA_EUPOC 3.58E+000 -8.90E+002 8.98E+002 1.26E+003 -22 43646.63 46268.82 TBA_EUPVA -3.61E+002 -9.45E+002 6.25E+002 1.19E+003 -22 43678.31 46191.85 TBA_HAECO -5.01E+002 -9.24E+002 1.01E+003 1.45E+003 -23 44184.78 46867.6 TBA_LEPSE 0 2420.34 2750.51 F TBA_LYTPI -8.32E+002 -1.07E+003 1.57E+003 2.07E+003 -11 15959.86 17858.74 TBA_MYCGR 1.31E+001 -1.13E+003 8.25E+001 1.13E+003 -24 43927.86 46753.33 TBA_NAEGR -4.44E+002 -1.04E+003 3.75E+002 1.19E+003 -23 44031.56 47036.09 TBA_NOTVI -1.47E+002 -8.20E+002 1.11E+003 1.39E+003 -24 44167.23 47197.14 TBAN_PHYPO -1.15E+002 -9.60E+002 8.97E+002 1.32E+003 -23 43607.45 45977.08 TBA_OCTDO -1.92E+002 -1.38E+003 1.19E+003 1.84E+003 -22 44189.74 46624.65 TBA_OCTVU -3.40E+002 -1.21E+003 1.28E+003 1.79E+003 -12 23897.38 25881.13 F TBA_ONCKE -1.99E+002 -1.15E+003 1.11E+003 1.61E+003 -24 43491.82 46581.51 TBA_OXYGR -8.66E+001 -1.08E+003 8.99E+002 1.41E+003 -23 43713.34 46373.82 TBA_PICAB -1.02E+002 -9.19E+001 -1.23E+002 1.84E+002 -10 11088.01 12137.53 F TBA_PIG -4.06E+002 -1.20E+003 6.32E+002 1.42E+003 -25 44083.31 46762.84 TBA_PLAFK -6.63E+002 -1.02E+003 1.09E+003 1.64E+003 -22 44159.95 46868.83 TBA_PLAYO -4.57E+002 -9.08E+002 9.83E+002 1.41E+003 -12 19399.72 20787.14 F TBA_PRUDU -2.93E+002 -1.09E+003 7.65E+002 1.36E+003 -23 43611.95 46257.89 TBA_SORMA -5.77E+001 -5.78E+002 8.84E+002 1.06E+003 -23 43781.31 46691.13 TBA_TETPY 1.49E+002 -8.36E+002 8.32E+002 1.19E+003 -21 43728.45 46142.49 TBA_TETTH -5.13E+001 -7.26E+002 8.46E+002 1.12E+003 -21 43757.64 46334.88 TBAT_ONCMY -1.81E+002 -1.07E+003 8.98E+002 1.41E+003 -23 44043.36 46640.52 TBA_TORMA -2.02E+002 -1.15E+003 6.45E+002 1.33E+003 -24 44318.53 47358.43 TBA_TOXGO 2.03E+002 -1.08E+003 1.11E+003 1.56E+003 -23 44098.44 46708.74 TBATRYBR -1.72E+002 -1.00E+003 8.63E+002 1.33E+003 -24 43867.8 46476.58 TBA_TRYCR -3.14E+002 -1.05E+003 9.14E+002 1.42E+003 -25 43758.17 46172.03 TBA_WHEAT 2.00E+002 -6.80E+002 1.39E+003 1.56E+003 -24 43805.34 46562.2 TBA_XENLA -2.31E+002 -1.10E+003 6.83E+002 1.31E+003 -23 43943 46478.64 TBB1_ANEPH -2.40E+002 -6.68E+002 1.53E+003 1.69E+003 -21 43331.36 45949.82 F TBB1_ARATH -1.22E+003 -1.02E+003 2.69E+003 3.13E+003 -27 43751.93 46146.83 TBB1_AVESA -8.00E+002 -1.71E+003 2.56E+003 3.18E+003 -25 38101.3 41156.74 TBB1_BRUPA -2.70E+002 -6.98E+002 1.81E+003 1.96E+003 -26 43981.4 46705.33 TBB1_CHICK -1.13E+003 -1.02E+003 1.51E+003 2.15E+003 -25 43815.13 46865.04 TBB1_CHOCR -6.25E+002 2.36E+002 1.77E+003 1.89E+003 -27 43977.7 45918.5 TBB1_COLGL -1.39E+003 -1.22E+003 3.07E+003 3.58E+003 -24 43616.55 45527.47 TBB1_COLGR -2.58E+002 -6.84E+002 2.23E+003 2.35E+003 -24 43341.08 45417.82 TBB1_CYAPA -1.03E+003 -1.03E+003 1.46E+003 2.06E+003 -25 43703.53 46639.47 TBB1_DAUCA -1.29E+003 -4.57E+002 2.76E+003 3.08E+003 -17 31337.94 33360.35 TBB1_ELEIN -1.10E+003 -1.03E+003 2.71E+003 3.10E+003 -26 43749.89 46609.62 TBB1_EMENI -3.24E+002 -1.74E+003 1.74E+003 2.48E+003 -23 43750.84 46675.24 TBB1_GADMO -1.02E+003 -1.16E+003 1.20E+003 1.95E+003 -25 43817.93 47122.12 TBB1_GEOCN -9.55E+002 -9.87E+002 1.33E+003 1.91E+003 -24 43808.6 46274.2 TBB1_HOMAM -1.24E+003 -1.24E+003 2.66E+003 3.19E+003 -24 44266.15 45948.21 TBB1_HUMAN -4.95E+002 -1.36E+003 2.04E+003 2.50E+003 -25 43765.02 46853.55 TBB1_LUPAL -1.56E+003 -1.20E+003 2.93E+003 3.53E+003 -25 43898.24 46734.22 TBB1_MAIZE -8.98E+002 -1.44E+003 2.28E+003 2.84E+003 -25 43776.83 46781.39 TBB1_MANSE 3.26E+001 -4.73E+002 1.77E+003 1.83E+003 -25 44083.08 46838.17 TBB1_NOTCO -9.76E+002 -1.32E+003 2.51E+003 3.00E+003 -25 43698.37 46442.69 TBB1_ORYSA -1.04E+003 -1.14E+003 1.59E+003 2.22E+003 -25 43757.44 46832.09 TBB1_PARTE -1.64E+002 -1.30E+003 1.62E+003 2.08E+003 -24 43491.13 46266.33 TBB1_PEA -1.68E+003 -1.21E+003 3.14E+003 3.76E+003 -26 44208.97 46988.05 F TBB1_PHYPO -2.55E+002 -9.30E+002 1.51E+003 1.79E+003 -23 TBB1_PORPU -9.28E+002 -9.18E+002 2.05E+003 2.43E+003 -28 43887.44 47046.49 F TBB1_RAT -1.24E+003 -1.25E+003 2.47E+003 3.04E+003 -25 43855.58 46823.88 TBB1_SOLTU -1.31E+003 -1.08E+003 3.00E+003 3.45E+003 -26 43921.08 45964.17 TBB1_SOYBN -1.99E+002 -1.02E+003 1.77E+003 2.06E+003 -22 43716.86 46392.04 TBB1_TRIVI -2.09E+002 -1.21E+003 1.46E+003 1.91E+003 -21 43239.19 45386.6 TBB1_VOLCA -5.67E+002 -1.31E+003 1.89E+003 2.37E+003 -24 43622.7 46596.3 TBB1_WHEAT -8.62E+002 -8.33E+002 2.00E+003 2.33E+003 -25 44053.19 47377.04 TBB2_ANEPH -2.34E+002 -1.01E+003 1.48E+003 1.81E+003 -18 40451.27 43579.53 TBB2_ARATH -1.86E+003 -8.40E+002 3.47E+003 4.03E+003 -27 44380.25 47532.89 TBB2_CAEEL -1.22E+003 -1.30E+003 2.60E+003 3.15E+003 -24 44042.41 46516.26 TBB2_CHICK -9.85E+002 -1.18E+003 2.51E+003 2.94E+003 -24 43790.78 46641.57 TBB2_COLGL 4.51E+001 -1.25E+003 2.44E+003 2.74E+003 -24 43772.28 46801.36 TBB2_COLGR -6.48E+002 -1.73E+003 2.32E+003 2.96E+003 -24 43776.26 46725.65 TBB2DAUCA -3.80E+002 -1.04E+003 1.48E+003 1.85E+003 -25 43469.26 46734.07 TBB2_DROER -1.53E+003 -1.19E+003 3.02E+003 3.59E+003 -25 43757.19 46469.02 TBB2_DROME -1.08E+003 -1.15E+003 2.59E+003 3.03E+003 -26 43646.93 46257.22 TBB2_ELEIN -5.42E+002 -6.38E+002 2.37E+003 2.52E+003 -26 44115.31 47287.17 TBB2_EMENI -3.49E+002 -1.26E+003 2.11E+003 2.48E+003 -22 43740.18 46549.31 TBB2_ERYPI -1.03E+003 -1.43E+003 1.94E+003 2.62E+003 -22 43844.47 46799.54 TBB2_GEOCN -1.16E+003 -5.41E+002 2.71E+003 3.00E+003 -28 44192.98 46317.34 TBB2_HOMAM -4.43E+002 -9.20E+001 2.03E+003 2.08E+003 -24 44467.04 45943.42 TBB2_HUMAN -1.83E+002 -1.53E+003 1.72E+003 2.31E+003 -25 43874.46 47063.85 TBB2_LUPAL -1.68E+003 -1.16E+003 3.46E+003 4.02E+003 -26 44006.64 46759.35 TBB2_MAIZE -9.72E+002 -1.25E+003 2.49E+003 2.95E+003 -23 43627.92 46573.3 TBB2_ORYSA -7.82E+002 -1.02E+003 1.61E+003 2.06E+003 -25 44025.13 47076.73 TBB2_PEA -1.87E+003 -1.43E+003 2.80E+003 3.66E+003 -28 44119.64 47264.21 TBB2_PHYPO -1.62E+003 -9.87E+002 3.29E+003 3.80E+003 -24 44197.53 47050.16 TBB2_PORPU -8.84E+002 -5.18E+002 1.80E+003 2.07E+003 -27 41546.31 44676.99

TBB2_SOLTU -9.18E+002 -1.31E+003 2.27E+003 2.78E+003 -26 44046.81 46135.05 TBB2_SOYBN -1.21E+003 -1.42E+003 2.75E+003 3.32E+003 -26 44355.5 47559.1 TBB2_TRIVI -5.10E+002 -9.99E+002 2.41E+003 2.66E+003 -24 43739.12 46059.81 TBB2_WHEAT -1.29E+003 -8.96E+002 3.24E+003 3.61E+003 -27 43864.6 46565.28 TBB2_XENLA -8.81E+002 -8.68E+002 1.96E+003 2.32E+003 -24 43639.84 46526.04 TBB3_ANEPH -7.63E+002 -8.82E+002 1.87E+003 2.20E+003 -9 24028.31 25945.03 F TBB3_CHICK -1.48E+003 -1.08E+003 3.01E+003 3.52E+003 -26 43756.1 46490.85 TBB3_DROME -1.29E+003 -1.65E+003 2.45E+003 3.22E+003 -23 44396.18 46320.02 TBB3_ELEIN -1.51E+003 -1.19E+003 2.31E+003 3.00E+003 -27 43974.3 47141.63 TBB3_MAIZE -1.40E+003 -1.05E+003 2.84E+003 3.34E+003 -25 43485.86 46040.71 TBB3_ORYSA -1.39E+003 -9.58E+002 2.79E+003 3.26E+003 -27 43797.24 46373.71 TBB3_PEA -1.46E+003 -1.53E+003 2.81E+003 3.52E+003 -27 43323.16 46648.94 F TBB3_PORPU -1.17E+003 -1.14E+003 2.60E+003 3.07E+003 -26 43529.91 46185.14 TBB3_SOYBN 4.79E+002 -1.01E+003 -2.15E+002 1.14E+003 -9 40339.02 43199.08 F TBB3_WHEAT -1.42E+003 -1.03E+003 3.02E+003 3.49E+003 -28 43670.95 46343.03 TBB4_ARATH -1.06E+003 -1.21E+003 2.38E+003 2.87E+003 -25 43750.97 46535.59 TBB4_CAEEL -1.01E+003 -1.29E+003 1.88E+003 2.49E+003 -24 43683.61 46649.3 TBB4_CHICK -1.14E+003 -1.37E+003 2.71E+003 3.24E+003 -24 44048.85 46490.78 TBB4_ELEIN -1.14E+003 -9.75E+002 2.27E+003 2.72E+003 -25 43906.03 46993.99 TBB4_HUMAN -1.15E+003 -8.25E+002 2.06E+003 2.49E+003 -25 44223.15 47073.77 TBB4_MAIZE -1.01E+003 -9.45E+002 2.18E+003 2.58E+003 -24 43757.47 46283.88 TBB4_PORPU -1.71E+003 -1.27E+003 2.68E+003 3.42E+003 -28 44129.26 47186.23 TBB4_WHEAT -7.03E+002 -1.24E+003 2.34E+003 2.75E+003 -25 43821.6 47046.07 TBB4_XENLA -1.18E+003 -1.11E+003 2.71E+003 3.16E+003 -24 43722.48 46674.76 TBB5_ARATH -1.80E+003 -1.08E+003 3.25E+003 3.86E+003 -28 44001.8 46634.56 TBB5_CHICK -7.93E+002 -1.16E+003 2.21E+003 2.62E+003 -25 43891.79 46604.44 TBB5_ECTVR -1.27E+003 -1.16E+003 2.72E+003 3.22E+003 -25 43750.92 46441.18 TBB5_HUMAN -8.71E+002 -1.12E+003 1.95E+003 2.41E+003 -24 43580.58 46339.09 TBB5_MAIZE -1.23E+003 -1.21E+003 2.47E+003 3.01E+003 -24 43798.93 46550.2 TBB5_WHEAT -7.11E+002 -7.94E+002 2.47E+003 2.69E+003 -26 44109.94 47148.65 TBB6_ARATH -1.78E+003 -1.24E+003 2.49E+003 3.30E+003 -28 44352.88 47605.4 TBB6_CHICK -1.10E+001 -1.14E+003 1.81E+003 2.14E+003 -20 44013.78 46378.76 TBB6_ECTVR -1.19E+003 -1.20E+003 2.80E+003 3.27E+003 -24 43894.94 46566.79 TBB6_MAIZE -8.83E+002 -1.00E+003 1.53E+003 2.03E+003 -25 44054.31 47248.64 TBB7_ARATH -1.53E+003 -1.27E+003 3.15E+003 3.72E+003 -26 44339.38 47096.68 TBB7_CAEBR -2.49E+002 -1.05E+003 1.53E+003 1.87E+003 -21 43204.36 45682.33 TBB7_CAEEL -1.65E+002 -9.89E+002 1.48E+003 1.79E+003 -19 43248.82 45913.33 TBB7_CHICK -1.07E+003 -1.20E+003 2.50E+003 2.97E+003 -24 43586.17 46372.26 TBB7_MAIZE -1.62E+003 -1.02E+003 3.29E+003 3.81E+003 -28 43810.2 46505.18 TBB8_ARATH -1.44E+003 -1.09E+003 3.25E+003 3.72E+003 -25 44295.12 47021.18 TBB8_MAIZE -2.88E+002 -1.30E+003 1.98E+003 2.39E+003 -25 43821.89 47069.82 TBB9_ARATH -1.85E+002 -1.19E+003 1.87E+003 2.22E+003 -27 43541.37 46710.21 TBB_ACHKL -1.49E+003 -1.18E+003 2.78E+003 3.37E+003 -27 43582.08 46093.01 TBB_ACRCO -2.96E+002 -1.68E+003 2.83E+003 3.31E+003 -25 44030.34 47131.02 TBB_AJECA -1.90E+001 -1.42E+003 1.43E+003 2.02E+003 -17 43899.95 46111.64 TBB_ASPFL -1.25E+003 -1.07E+003 3.51E+003 3.88E+003 -23 43818.01 46347.28 TBB_ASPPA -1.09E+003 -1.17E+003 3.41E+003 3.77E+003 -23 43974.21 46807.66 TBB_BABBO -7.24E+001 -9.18E+002 9.11E+002 1.30E+003 -22 43389.67 46335.4 TBB_BOMMO -1.75E+002 -1.61E+003 3.52E+003 3.87E+003 -25 44236.29 47190.27 TBB_BOTCI -8.12E+001 -1.52E+003 2.48E+003 2.91E+003 -22 43733.8 46687 TBB_CANAL -7.66E+002 -1.32E+003 2.58E+003 3.00E+003 -27 43649.84 45896.27 TBB_CEPAC -6.54E+002 -1.75E+003 2.46E+003 3.09E+003 -24 43755.92 46590.03 TBB_CHLIN -8.12E+002 -1.08E+003 2.18E+003 2.56E+003 -24 43440.63 46047.48 TBB_CHLRE -7.63E+002 -1.04E+003 1.67E+003 2.11E+003 -24 43580.97 46513.44 TBB_CICAR -1.47E+003 -1.26E+003 2.76E+003 3.37E+003 -26 44093.85 46346.37 TBB_DICDI -2.34E+002 -3.61E+002 2.34E+003 2.38E+003 -25 44756.23 46368.54 TBB_EIMTE -8.00E+002 -1.16E+003 2.38E+003 2.76E+003 -24 43849.31 46691.1 TBB_EPITY -1.72E+002 -9.30E+002 2.54E+003 2.71E+003 -24 43981.99 47087.79 TBB_ERYGR -1.11E+003 -1.62E+003 2.49E+003 3.17E+003 -21 43521.09 46022.36 TBB_EUGGR -5.27E+002 -9.96E+002 1.74E+003 2.08E+003 -28 43338.8 45940.86 TBB_EUPCR -1.29E+003 -1.16E+003 2.41E+003 2.97E+003 -26 43733.12 46318.45 TBB_EUPFO -3.46E+002 -9.23E+002 2.17E+003 2.38E+003 -23 43736.75 46621.81 TBB_EUPOC -1.09E+003 -1.05E+003 2.34E+003 2.79E+003 -25 43474.13 46098.76 TBB_GIALA -1.11E+003 -9.79E+002 2.43E+003 2.85E+003 -24 43973.16 47134.22 TBB_GIBFU -1.09E+003 -1.15E+003 3.42E+003 3.76E+003 -24 43717.6 46450.54 TBB_HALDI 2.70E+002 -1.27E+003 5.88E+002 1.43E+003 -5 33789.64 36441.03 F TBB_HORVU -1.62E+003 -1.07E+003 3.28E+003 3.82E+003 -27 43828.44 46711.06 TBB_LEIME -4.57E+002 -1.16E+003 1.79E+003 2.18E+003 -25 43640.51 46103.21 TBB_LYMST -4.11E+002 9.15E+001 1.44E+003 1.50E+003 -16 11210.57 12653.09F TBB_LYTPI -1.31E+003 -6.00E+002 3.00E+003 3.33E+003 -13 17813.1 19768.08F TBB_MYCPJ -1.06E+003 -1.44E+003 3.06E+003 3.54E+003 -22 43590.41 46322.14 TBB_NAEGR -9.11E+002 -1.50E+003 2.96E+003 3.44E+003 -26 44385.1 47524.01 TBB_NEUCR -8.67E+002 -1.30E+003 3.63E+003 3.95E+003 -24 43678.94 46401.01 TBB_OCTDO -7.15E+002 -5.08E+002 1.86E+003 2.06E+003 -23 44106.16 46618.28 TBB_ONCGI -7.02E+002 -1.07E+003 2.06E+003 2.42E+003 -21 43865.63 46450.72 TBB_PARLI -1.51E+003 -1.20E+003 3.26E+003 3.78E+003 -26 43883.1 46679.47 TBB_PENDI -4.37E+002 -1.44E+003 2.26E+003 2.71E+003 -21 43814.64 46891.07 TBB_PESMI -3.95E+002 -1.50E+003 2.53E+003 2.97E+003 -24 43722.64 46550.51 TBB_PHANO -7.61E+002 -1.12E+003 2.67E+003 2.99E+003 -21 43777.75 46470 TBB_PHYCI -6.90E+002 -1.01E+003 1.92E+003 2.27E+003 -24 43659.2 46213.31 TBB_PIG -3.59E+002 -1.55E+003 1.91E+003 2.48E+003 -25 43854.42 47042.18 TBB_PLASA -6.56E+002 -1.43E+003 1.55E+003 2.21E+003 -28 43731.91 46620.07 TBB_PLAFK -1.06E+003 -1.24E+003 1.40E+003 2.14E+003 -27 43684.84 46607.02 TBB_PLESA -1.51E+003 -1.06E+003 2.51E+003 3.12E+003 -25 44047.21 46981.21 TBB_PNECA 5.85E+001 -7.05E+002 1.77E+003 1.90E+003 -22 43093.29 45488.54 TBB_POLAG -9.12E+002 -1.12E+003 2.29E+003 2.71E+003 -24 43428.91 45898.77 TBB_PSEAM -1.11E+003 -1.06E+003 1.54E+003 2.18E+003 -25 43784.36 46877.34 TBBQ_HUMAN -2.77E+002 -7.68E+002 5.86E+002 1.00E+003 -18 42440.37 44994.21 TBB_RHYSE -1.13E+003 -1.49E+003 3.08E+003 3.60E+003 -21 43739.88 46423.03 TBB_SCHCO -7.83E+002 -1.13E+003 1.60E+003 2.11E+003 -25 43970.42 46854.63 TBB_SCHPO -4.48E+002 -8.91E+002 2.11E+003 2.33E+003 -27 43446.86 45913.99 TBB_STRPU -6.17E+002 -1.36E+003 3.07E+003 3.41E+003 -18 29275.73 31526.12 F TBB_STYLE -9.53E+002 -1.02E+003 2.15E+003 2.56E+003 -24 43277.04 45763.19 TBB_TETPY -5.66E+002 -8.36E+002 1.78E+003 2.05E+003 -24 43557.91 46339.63 TBB_TETTH -5.22E+002 -8.68E+002 1.71E+003 1.99E+003 -25 43553.05 46384.46 TBB_THAWE -9.42E+002 -1.14E+003 2.35E+003 2.78E+003 -23 43337.8 45963.07 TBB_TOXGO -1.44E+003 -1.21E+003 2.28E+003 2.96E+003 -27 43887.58 46652.72 TBB_TRYBR -9.50E+001 -1.16E+003 1.42E+003 1.84E+003 -24 43475.69 45924.44 TBB_TRYCR -5.27E+002 -1.06E+003 1.56E+003 1.96E+003 -25 43396.83 45908.56 TBB_VENIN -1.12E+003 -1.36E+003 3.10E+003 3.56E+003 -22 43549.74 46256.71 TBBX_HUMAN -1.07E+003 -1.20E+003 2.50E+003 2.97E+003 -24 43586.17 46372.26 TBB_YEAST -1.38E+003 -3.14E+002 3.25E+003 3.54E+003 -31 44568.68 47245.65 TBD_HUMAN -2.52E+002 -1.29E+003 3.67E+002 1.36E+003 -5 44650.69 45579.63 TBE_HUMAN 5.31E+002 -4.99E+002 4.47E+002 8.55E+002 -6 TBG1_HUMAN 7.16E+002 -1.58E+003 -6.03E+002 1.84E+003 -10 44645.36 45231.14 TBG1_MAIZE 8.07E+002 -1.90E+003 -3.86E+002 2.10E+003 -10 46058.94 46110.79 TBG1_MOUSE 5.56E+002 -1.71E+003 -8.73E+002 2.00E+003 -11 44751.95 45706.51 TBG2_ARATH 1.46E+003 -2.04E+003 5.26E+002 2.56E+003 -10 46598.89 47773.51 TBG2_DROME 8.15E+002 -1.58E+003 -8.50E+002 1.97E+003 -6 44800.18 45401.53 TBG2_EUPCR 3.78E+002 -1.86E+003 -7.45E+002 2.04E+003 -15 45632.97 46882.17 TBG2_EUPOC 4.42E+001 -2.22E+003 -3.12E+002 2.24E+003 -10 45771.97 47628.98 TBG2_HUMAN 5.46E+002 -1.57E+003 -3.46E+002 1.70E+003 -13 44707.12 45746.7 TBG2_MAIZE 4.62E+002 -1.85E+003 -5.21E+002 1.98E+003 -12 TBG2_MOUSE 3.57E+002 -1.22E+003 -6.91E+002 1.45E+003 -10 44770.54 45966.96 TBG2_ORYSA 7.37E+002 -1.71E+003 -6.59E+002 1.97E+003 -12 46151.43 46463.29 TBG3_MAIZE 7.36E+002 -1.95E+003 -1.05E+002 2.09E+003 -9 41586.56 42200.31 F TBG_ANEPH 1.48E+003 -2.35E+003 3.46E+002 2.79E+003 -9 46391.54 47490.67 TBG_CAEEL 3.04E+002 -1.06E+003 -8.91E+002 1.42E+003 -9 43944.74 45972.73 TBG_CANAL 1.34E+003 -1.39E+003 1.90E+003 2.71E+003 -23 TBG_CHLRE 7.24E+002 -1.85E+003 -3.37E+002 2.02E+003 -6 45684.61 46543.6 TBG_COCHE 4.43E+002 -8.17E+002 -5.81E+002 1.10E+003 -2 26054.95 27657.99 F TBG_EMENI 7.59E+002 -1.72E+003 -7.19E+002 2.01E+003 -9 44602.99 46275.01 TBG_ENTHI 1.65E+002 -9.20E+002 -8.38E+002 1.26E+003 -6 45398.09 46350.19 TBG_EUPAE 7.82E+002 -1.99E+003 -3.07E+002 2.16E+003 -10 45766.71 47108.63 TBG_NEUCR 5.63E+002 -1.98E+003 -3.09E+002 2.08E+003 -9 45255.26 46777.78 TBG_PHYPA 1.25E+003 -2.49E+003 2.51E+001 2.78E+003 -8 46549.14 47781.9 TBG_PLAFO 6.66E+002 -2.18E+003 -7.53E+002 2.40E+003 -7 45179.34 46542.13 TBG_RETFI 1.16E+003 -1.59E+003 -5.16E+002 2.04E+003 -4 47100.48 48598.68 TBG_SCHJP 1.95E+000 -1.81E+003 -6.21E+002 1.91E+003 -7 44087.45 45523.53 TBG_SCHPO 3.32E+002 -1.54E+003 -3.58E+002 1.62E+003 -8 43930.03 45423.04 TBG_USTVI 7.32E+002 -1.61E+003 -8.74E+002 1.97E+003 -10 45915.36 47039.01 TBG_XENLA 8.58E+002 -1.48E+003 -8.55E+002 1.91E+003 -9 44698.46 45367.78 TBG_YEAST 9.08E+002 -1.50E+003 1.31E+003 2.19E+003 -30 45777.95 47349.09

[0074] As is also disclosed in the Tuszynski paper, "FIG. 1a shows a scatter diagram of the net/charge/volume ratios of the different tubulins. This plot is striking in that the net charge on the beta-tubulins is bar far the greatest, ranging between -17 and -32 elementary charges (e) depending upon the particular beta-tubulin with an average value in this case at approximately -25e. Next comes the alpha-tubulins whose net charges vary between -10 and 1-25 elementary charges . . . . There appears to be little if any correlation between the size of a protein and its charge . . . . Further, it should be kept in mind, that the charge on a tubulin dimmer will be neutralized in solution due to the presence of counter-ions which almost completely screen the net charge. This was experimentally determined for tubulin by the application of an external electric field; the resulting value of an unscreened charge of approximately 0.2e per monomer was found Stracke et al. 2002." The reference to Stracke et al. was to an article by R. Stracke, J. A. Tuszynski, et al. regarding "Analysis of the migration behaviour of single microtubules in electric fields," Biochemical and Biophysical Research Communications, 293:606-609, 2002.

[0075] As is also disclosed in the Tuszynski paper, "What is, however, of great interest in connection with polymerization of tubulin into microtubules and with drug-protein binding is the actual distribution of charges on the surface of the tublin. FIG. 3 illustrates this for the Downing-Nogales structure with plus signs indicating the regions of positively charged and minus signs negatively charged locations. This figure shows C-termini in two very upright positions. Of course, each of the different tubulins will show differences in this regard . . . ."

[0076] As is also disclosed in the Tuszynski paper, " . . . alpha tubulins have relatively low dipole moments about their centres-of-mass, ranging between 1000 and 2000 Debye, while the beta-tubulins are very high in this regard with the corresponding values ranging between 1000 and 4000 Debye and with the average value close to 3000 Debye . . . . In FIG. 2 we have illustrated the important aspect of dipole organization for tubulin, namely its orientation. FIG. 2a shows a Mollweide projection of dipole orientation in tubulin . . . . We conclude from this diagram and its magnification . . . that both alpha- and beta-tubulins orient their dipose moments in a direction that is close to being perpendicular to the microtubule surface . . . ."

[0077] As is also disclosed in the Tuszynski paper, "FIG. 1c shows the logarithm of surface area against the logarithm of volume for the different tubulins . . . . Note that the alpha and beta families have a very similar slope with a value close to the unity that is indicative of cylindrical symmetry in the overall geometry . . . ."

[0078] As is also disclosed in the Tuszynski paper, "Our models show that only alpha- and beta-tubulins have C-termini that project outwards from the tubulin, due to their high negative charges. FIG. 5 shows the energy levels of different orientational positons of the C-termini in a toy model and suggests that there is relatively little energetic difference between projecting straight outward from the rest of the tublin and lying on the surface of tubulin in certain energy minima . . . ."

[0079] As is also disclosed in the Tuszynski et al. paper, "Isotype compositon has a demonstrable effect on microtubule assembly kinetics (Panda et al., 1994)." The Panda et al. reference was an article by D. Panda et al. on "Microtubule dynamics in vitro are regulated by the tubulin isotype composition," Proc. Natl. Acad. Sci. USA 91: 11 358-11 362, 1994.

[0080] As is also disclosed in the Tuszynski paper, "This could be due to changes in the electrostatics of tubulin, which although significantly screened by counter-ions does affect microtubule assembly by influencing dimer-dimer interactions over relatively short distances (approximagely 5 nm) as well as the kinetics of assembly. These short-range interactions have recently been studied by Sept et al. (2003) by calculating the energy of protofilament-protofilament interactions. These authors concluced from their work that the two types of microtubule lattices (A and B) correspond to the local energy minima." The Sept et al. reference was to an article by D. Sept et al., "The physical basis of microtubule structure and stability," Protein Science, 12:2257-2261, 2003.

[0081] As is also disclosed in the Tuszynski paper, "The dipole moment could play a role in microtubule assembly and in other processes. This could be instrumental in the docking process of molecules to tubulin and in the proper steric configuration of a tubulin dimer as it approaches a microtubule for binding. An isolated dimer has an electric field dominated by its net charge . . . . In contrast, a tubulin dimer . . . surrounded by water molecules and counter-ions, as is physiologically relevant, has an isopotential surface with two lobes much like the dumbbell shape of a mathematically dipole moment. The greater the dipole of of each of its units is, the less stable the microtubule since dipole-dipole interactions provide a positive energy disfavoring a microtubule structure. Note that the strength of the interaction potential is proportional to the square of the dipole moment, hence microtubule structuresformed from tubulin units with larger dipoles momements should be more prone to undergo disassembly catastrophes compoared to those microtubles that contain low dipole moment tubulins. For organisms that express more than one type of tubulin isotype in the same cell, one can conceive that microtubule dynamic behavior could be regulated by altering the relative amounts of the different isotypes according to their dipole moments."

[0082] As is also disclosed in the Tuszynski paper, "In terms of surface/volume ratios, .alpha.- and .beta.-tubulin are the least compact, while .gamma., .delta. and .epsilon. are the most compact. There is abundant evidence that both .alpha. and .beta. have flexible conformations. This is attested to by their interaction with drugs and is consistent with the dynamic instability of microtubules. In contrast, there is as yet no evidence of dynamic instability in .gamma., .delta. and .epsilon. partcipating in dynamic instability, nor is there any theoretical reason to imagine such flexibility. It is reasonable to postulate that a less compact structure may have a more flexible conformation."

[0083] As is also disclosed in the Tuszynski et al. paper, "Our models predict that the C-termini of .alpha. and .beta. can readily adopt the two extreme conformations: either projecting outwards from the tubulin (and the microtubule surface) or to lie on the surface, albeit such that theircharged residues can form electrostatic bonds with complimentary charges on the surface. The state of the C-terminus (upright, down, or in intermediate states) down) is easily influenced by the local ion concentration including pH. This conformational complexity has many implications (Pal et al., 2001)." The Pal et al. reference is an article by D. Pal et al. on "Conformational properties of alpha-tubulin tail peptide: implications for tail-body interaction," Biochemistry, 40: 15 512-15 519, 2001.

[0084] As is also disclosed in the Tuszynski paper, "First, a projecting C-terminus could play a major role in signaling. The fact that tubulin isotypes differ markedly in the C-termini suggests that specific sequences may mediate the functional roles of the isotypes. These sequences would be readily available for interactions with other proteins in a projecting C-terminus. Second, the C-termini are the sites of many of the post-translational modifications of tubulin--polyglutamylation, polyglycylation, detyrosinolation/tyrosinolation, removal of the penultimate glutamic acid, and phosphorylation of serine and tyrosine (Redeker et al., 1998)." The Redeker et al. reference was an article by V. Redekere et al. on "Posttranslational modifications of the C-terminus of alpha-tubulin in adult rat brain: alpha 4 is glutamylated at two residues," Biochemistry, 37: 14 838-14 844, 1998.

[0085] As is also disclosed in the Tuszynski paper, "It is known that the C-termini are essential to normal microtubule function (Duan and Gorovsky, 2002); a projecting C-terminus would be easily accessible to enzymes that affect these modifications and also the modification could influence the likelihood of the C-terminus changing conformation. In addition, if the modification plays a role in signaling then the signal would be readily available in a projecting C-terminus, as already mentioned." The reference to Duan and Gorovsky is to an article by J. Duan et al., "Both carboxy-termianl tails of alpha- and beta-tubulin are essential, but either one will suffice," Current Biology, 12:313-316, 2002.

[0086] As is also disclosed in the Tuszynski et al. paper, "Third, projecting C-termini would automatically create spacing between microtubules. It is known that microtubules are never closely packed and are surrounded by what is referred to as an exclusion zone.(Dustin, 1984)." The reference to Dustin is to a book by P. Dustin on "Microtubules (Springer-Verlag, Berlin, 1984).

[0087] As is also disclosed in the Tuszynski paper, "This is a region of space around them that strongly disfavors the presence of other microtubules in the vicinity. Although MAPs could play a role in such spacing, electrostatic repulsion among C-terminal ends are likely to influence this as well. The C-termini are the major sites of binding of the MAPs to tubulin. A projecting C-terminus may facilitate MAP binding and, conversely, MAP binding could influence the conformation of the C-terminus. Evidence for this is provided by the work of Makridis et al who showed that when tau binds to microtubules, it triggers a structural change on the microtubule surface whereby a structural element, presumably tau, lies along the surface of the microtubule forming a lattice whose alingement angle is much sharper than that of the tubulin subunits. This lattice is presumably superimposed on top of the normal microtubule (A or B) lattice. The orientation of the C-termini when they are lying on the surface of the microtubule form exactly the same kind of lattice that (Makridis et al, 2003) observed, a striking confirmation of the potential accuracy of our modeling . . . . These results raise the possibility that the orientation of the C-termini of the alpha and beta subunits determines the arrangement of tau molecules on the microtubule." The Makrides reference referred to is an article by V. Markrides et al., "Microtubule-dependent oligomerization of tau: Implicatons for physiological tau function and tauopathies," J. Biol. Chem., 278:33 298-33 304, 2003.

[0088] As is also disclosed in the Tuszynski et al. paper, " . . . the state of the C-termini could mediate how motor proteins such as kinesin bind to and move on microtubules. Our models show that kinesin can only bind to upright C-termini . . . and not to C-termini lying on the surface of the microtubule . . . . Very minor changes in the local ionic environment or the pH could halt the progress of kinesin by collapsing the C-termini. One can postulate that the proportion of C-termini that are in the upright conformation in a given portion of the microtubule could determine the actual rate of kinesin movement. It is likely that such arguments could apply to other motor proteins as well. One might imagine that the very fine coordination of movements that occur in processes such as mitosis could be influenced or even caused by the conformational state of the C-termini in particular areas of the microtubule."

[0089] As is also disclosed in the Tuszynski paper, "Finally, one can imagine that the C-termini could collapse in waves that could simultaneously move a wave of ions that could polarize or depolarize a membrane. This could be a form of microtubule signaling that has not yet been considered. A quantitative model of ionic wave transmission coupled to co-ordinated motion of the C-termini of dendritic microtubules has been recently developed by Priel et al. . . . ." The refererence to Priel et al. was to an article by A. Priel et al. entitled "Moleuclar Dynamics of C-termini in Tubulin: Implications for Transport to Active Synapsis," submitted to Biophys. J., 2003.

[0090] Table 1 of the Tuszynksi paper disclosed the tubulin sequences used in the study reported in the article. In such Table 1, the table names the names the source organism, and for each .alpha., .beta., .gamma., .delta., and .epsilon., gives the name used in the databank.

The Use of Particular Models of Isotypes of Tubulin for Drug Development

[0091] In one embodiment of the invention, once a particular tubulin isotype has been identified as being of interest, and once a three-dimensional model of it has been made in accordance with the process of this invention, this model may then be used to identify which drug or drugs would most advantageously interact with the binding sites of the tubulin isotype in question.

[0092] The preferred binding sites which may be used in the process of identifying the candidate drugs are discussed in the next section of this specification.

Preferred Binding Sites of Tubulin Isotypes

[0093] It is known that many chemotherapeutic drugs effect their primary actions by inhibiting tubulin polymerization. Thus, as is disclosed in U.S. Pat. No. 6,162,930 (the entire disclosure of which is hereby incorporated by reference into this specification), "An aggressive chemotherapeutic strategy toward the treatment and maintenance of solid-tumor cancers continues to rely on the development of architecturally new and biologically more potent anti-tumor, anti-mitotic agents. A variety of clinically-promising compounds which demonstrate potent cytotoxic and anti-tumor activity are known to effect their primary mode of action through an efficient inhibition of tubulin polymerization (Gerwick et al.). This class of compounds undergoes an initial binding interaction to the ubiquitous protein tubulin which in turn arrests the ability of tubulin to polymerize into microtubules which are essential components for cell maintenance and cell division (Owellen et al.)."

[0094] U.S. Pat. No. 6,162,930 also discloses that the precise means by which the cytotoxic agents " . . . arrests the ability of tubulin to polymerize . . . " is unknown, stating that: "Currently the most recognized and clinically useful tubulin polymerization inhibitors for the treatment of cancer are vinblastine and vincristine (Lavielle, et al.). Additionally, the natural products rhizoxin (Nakada, et al., 1993a and 1993b; Boger et al.; Rao et al., 1992 and 1993; Kobayashi et al., 1992 and 1993) combretastin A-4 and A-2 (Lin et al.; Pettit, et al., 1982, 1985, and 1987) and taxol (Kingston et al.; Schiff et al; Swindell, et a, 1991; Parness, et al.) as well as certain synthetic analogues including the 2-styrylquinazolin-4(3H)-ones (SQO) (Jiang et al.) and highly oxygenated derivatives of cis- and trans-stilbene (Cushman et al.) and dihydrostilbene are all known to mediate their cytotoxic activity through a binding interaction with tubulin. The exact nature of this interaction remains unknown and most likely varies somewhat between the series of compounds."

[0095] U.S. Pat. No. 6,512,003 also discusses the " . . . nature of this unknown interaction . . . ," stating that (at column 1) "Novel tubulin-binding molecules, which, upon binding to tubulin, interfere with tubulin polymerization, can provide novel agents for the inhibition of cellular proliferation and treatement of cancer." U.S. Pat. No. 6,512,003 presents a general discussion of the role of tubulin in cellular proliferation, disclosing (also at column 1) that: Cellular proliferation, for example, in cancer and other cell proliferative disorders, occurs as a result of cell division, or mitosis. Microtubules play a pivotal role in mitotic spindle assembly and cell division . . . . These cytoskeletal elements are formed by the self-association of the ad tubulin heterodimers . . . . Agents which induce depolymerization of tubulin and/or inhibit the polymerization of tubulin provide a therapeutic approach to the treatment of cell proliferation disorders such as cancer. Recently, the structure of the .alpha..beta. tubulin dimer was resolved by electron crystallography of zinc-induced tubulin sheets . . . . According to the reported atomic model, each 46.times.40.times.65 .ANG. tubulin monomer is made up of a 205 amino acid N-terminal GTP/GDP binding domain with a Rossman fold topology typical for nucleotide-binding proteins, a 180 amino acid intermediate domain comprised of a mixed .beta. sheet and five helices which contain the taxol binding site, and a predominantly helical C-terminal domain implicated in binding of microtubule-associated protein (MAP) and motor proteins . . . ."

[0096] U.S. Pat. No. 6,512,003 also teaches that the the binding site of vinca alkaloids to tubulin differs from the binding site of colchicin to tublin, stating (also at column 1) that: "Spongistatin (SP) . . . is a potent tubulin depolymerizing natural product isolated from an Eastern Indian Ocean sponge in the genus Spongia . . . Spongistatins are 32-membered macrocyclic lactone compounds with a spongipyran ring system containing 4 pyran-type rings incorporated into two spiro[5.5]ketal moieties . . . . In cytotoxicity assays, spongistatin (SP) exhibited potent cytotoxicity with subnanomolar IC50 values against an NCI panel of 60 human cancer cell lines . . . . SP was found to inhibit the binding of vinc alkaloids (but not colchicin) to tubulin . . . , indicating that the binding site for this potent tubulin depolymerizing agent may also serve as a binding region for vinc alkaloids."

[0097] U.S. Pat. No. 6,593,374, the entire disclsoure of which is hereby incorporated by reference into this specification, presents a "working hypothesis" that the " . . . methoxy aryl functionality . . . " is especially important for binding at the colchicin binding site. It discloses (at columns 1-2 thereof) that: "An important aspect of this work requires a detailed understanding, on the molecular level, of the `small molecule` binding domain of both the .alpha. and .beta. subunits of tubulin. The tertiary structure of the .alpha.,.beta. tubulin heterodimer was reported in 1998 by Downing and co-workers at a resolution of 3.7 .ANG. using a technique known as electron crystallography . . . . This brilliant accomplishment culminates decades of work directed toward the elucidation of this structure and should facilitate the identification of small molecule binding sites, such as the colchicine site, through techniques such as photoaffinity and chemical affinity labeling . . . . We have developed a working hypothesis suggesting that the discovery of new antimitotic agents may result from the judicious combination of a molecular template (scaffold) which in appropriately substituted form (ie. phenolic moieties, etc.) interacts with estrogen receptor (ER), suitably modified with structural features deemed imperative for tubulin binding (arylalkoxy groups, certain halogen substitutions, etc.). The methoxy aryl functionality seems especially important for increased interaction at the colchicine binding site in certain analogs . . . . Upon formulation of this hypothesis concerning ER molecular templates, our initial design and synthesis efforts centered on benzo[b]thiophene ligands modeled after raloxifene, the selective estrogen receptor modulator (SERM) developed by Eli Lilly and Co . . . . Our initial studies resulted in the preparation of a very active benzo[b]thiophene-based antitubulin agent . . . . In further support of our hypothesis, recent studies have shown that certain estrogen receptor (ER) binding compounds as structurally modified estradiol congeners (2-methoxyestradiol, for example) interact with tubulin and inhibit tubulin polymerization . . . . Estradiol is, of course, perhaps the most important estrogen in humans, and it is intriguing and instructive that the addition of the methoxy aryl motif to this compound makes it interactive with tubulin. It is also noteworthy that 2-methoxyestradiol is a natural mammalian metabolite of estradiol and may play a cell growth regulatory role especially prominent during pregnancy. The term `phenolic moiety` means herein a hydroxy group when it refers to an R group on an aryl ring."

[0098] As is also disclsoed in U.S. Pat. No. 6,593,374 (at column 1 thereof), "Tubulin is currently among the most attractive therapeutic targets in new drug design for the treatment of solid tumors. The heralded success of vincristine and taxol along with the promise of combretastatin A-4 (CSA-4) prodrug and dolastatin . . . , to name just a few, have firmly established the clinical efficacy of these antimitotic agents for cancer treatment. An aggressive chemotherapeutic strategy toward the treatment and maintenance of solid-tumor cancers continues to rely on the development of architecturally new and biologically more potent anti-tumor, anti-mitotic agents which mediate their effect through a direct binding interaction with tubulin. A variety of clinically-promising compounds which demonstrate potent cytotoxicity and antitumor activity are known to effect their primary mode of action through an efficient inhibition of tubulin polymerization . . . . This class of compounds undergoes an initial interaction (binding) to the ubiquitous protein tubulin which in turn arrests the ability of tubulin to polymerize into microtubules which are essential components for cell maintenance and division . . . . During metaphase of the cell cycle, the nuclear membrane has broken down and the cytoskeletal protein tubulin is able to form centrosomes (also called microtubule organizing centers) and through polymerization and depolymerization of tubulin the dividing chromosomes are separated. Currently, the most recognized and clinically useful members of this class of antimitotic, antitumor agents are vinblastine and vincristine . . . along with taxol . . . . Additionally, the natural products rhizoxin, . . . combretastatin A-4 and A-2, . . . curacin A, . . . podophyllotoxin, . . . epothilones A and B, . . . dolastatin 10 . . . and welwistatin . . . (to name just a few) as well as certain synthetic analogues including phenstatin, . . . the 2-styrylquinazolin-4(3H)-ones (SQO), . . . and highly oxygenated derivatives of cis- and trans-stilbene . . . and dihydrostilbene are all known to mediate their cytotoxic activity through a binding interaction with tubulin. The exact nature of this binding site interaction remains largely unknown, and definitely varies between the series of compounds."

[0099] Published United States patent application 2004/0044059, the entire disclosure of which is hereby incorporated by reference into this specification, also discloses the uncertaintly that exists with regard to the " . . . tubulin binding site interactions . . . ." At page 1 thereof, it states that: "The exact nature of tubulin binding site interactions remain largely unknown, and they definitely vary between each class of Tubulin Binding Agent. Photoaffinity labeling and other binding site elucidation techniques have identified three key binding sites on tubulin: 1) the Colchicine site (Floyd et al, Biochemistry, 1989; Staretz et al, J. Org. Chem., 1993; Williams et al, J. Biol. Chem., 1985; Wolff et al, Proc. Natl. Acad. Sci. U.S.A., 1991),2) the Vinca Alkaloid site (Safa et al, Biochemistry, 1987), and 3) a site on the polymerized microtubule to which taxol binds (Rao et al, J. Natl. Cancer Inst., 1992; Lin et al, Biochemistry, 1989; Sawada et al, Bioconjugate Chem, 1993; Sawada et al, Biochem. Biophys. Res. Commun., 1991; Sawada et al, Biochem. Pharmacol., 1993). An important aspect of this work requires a detailed understanding, at the molecular level, of the `small molecule` binding domain of both the .alpha. and .beta. subunits of tubulin. The tertiary structure of the .alpha.,.beta. tubulin heterodimer was reported in 1998 by Downing and co-workers at a resolution of 3.7 using a technique known as electron crystallography (Nogales et al, Nature, 1998). This brilliant accomplishment culminates decades of work directed toward the elucidation of this structure and should facilitate the identification of small molecule binding sites, such as the colchicine site, using techniques such as photoaffinity and chemical affinity labeling (Chavan et al, Bioconjugate Chem., 1993; Hahn et al, Photochem. Photobiol., 1992)."

[0100] As is also disclosed in published United States patent application 2004/0044059, "The cytoskeletal protein tubulin is among the most attractive therapeutic drug targets for the treatment of solid tumors. A particularly successful class of chemotherapeutics mediates its anti-tumor effect through a direct binding interaction with tubulin. This clinically-promising class of therapeutics, called Tubulin Binding Agents, exhibit potent tumor cell cytotoxicity by efficiently inhibiting the polymerization of .alpha..beta.-tubulin heterodimers into the microtubule structures that are required for facilitation of mitosis or cell division (Hamel, Medicinal Research Reviews, 1996) . . . . Currently, the most recognized and clinically useful antitumor agents are Vinca Alkaloids, such as Vinblastine and Vincristine (Owellen et al, Cancer Res., 1976; Lavielle et al, J. Med. Chem., 1991) along with Taxanes such Taxol (Kingston, J. Nat. Prod., 1990; Schiff et al, Nature, 1979; Swindell et al, J. Cell Biol., 1981). Additionally, natural products such as Rhizoxin (Nakada et al, Tetrahedron Left., 1993; Boger et al, J. Org. Chem., 1992; Rao, et al, Tetrahedron Lett., 1992; Kobayashi et al, Pure Appl. Chem., 1992; Kobayashi et al, Indian J. Chem., 1993; Rao et al, Tetrahedron Lett., 1993), the Combretastatins (Lin et al, Biochemistry, 1989; Pettit et al, J. Nat. Prod., 1987; Pettit et al, J. Org. Chem., 1985; Pettit et al, Can. J. Chem., 1982; Dorr et al, Invest. New Drugs, 1996), Curacin A (Gerwick et al, J. Org. Chem., 59:1243, 1994), Podophyllotoxin (Hammonds et al, J. Med. Microbiol, 1996; Coretese et al, J. Biol. Chem., 1977), Epothilones A and B (Nicolau et al., Nature, 1997), Dolastatin-10 (Pettit et al, J. Am. Chem. Soc., 1987; Pettit et al, Anti-Cancer Drug Des., 1998), and Welwistatin (Zhang et al, Molecular Pharmacology, 1996), as well as certain synthetic analogues including Phenstatin (Pettit G R et al., J. Med. Chem., 1998), 2-styrylquinazolin-4(3H)-ones ("SQOs", Jiang et al, J. Med. Chem., 1990), and highly oxygenated derivatives of cis- and trans-stilbene and dihydrostilbene (Cushman et al, J. Med. Chem., 1991) are all known to mediate their tumor cytotoxic activity through tubulin binding and subsequent inhibition of mitosis."

[0101] As is also disclosed in published United States patent application 2004/0044059, "Normally, during the metaphase of cell mitosis, the nuclear membrane has broken down and tubulin is able to form centrosomes (also called microtubule organizing centers) which facilitate the formation of a microtubule spindle apparatus to which the dividing chromosomes become attached. Subsequent polymerization and depolymerization of the spindle apparatus mitigates the separation of the daughter chromosomes during anaphase such that each daughter cell contains a full complement of chromosomes. As antiproliferatives or antimitotic agents, Tubulin Binding Agents exploit the relatively rapid mitosis that occurs in proliferating tumor cells. By binding to tubulin and inhibiting the formation of the spindle apparatus in a tumor cell, the Tubulin Binding Agent can cause significant tumor cell cytotoxicity with relatively minor effects on the slowly-dividing normal cells of the patient."

[0102] An article by Mary Ann Jordan et al., entitled "Microtubules as a target for anticancer drugs," appeared in Nature Reviews/Cancer, Volume 4, April 2004, pages 253-266. At page 253 of this article, it was disclosed that: "Microtubles are extremely important in the process of mitosis . . . . Their importance in mitosis and cell divison makes microtubles an important target for anticancer drugs. Microtubules and their dynamics are the targets of a chemically diverse group of antimitotic drugs (with various tubulin-binding sites) that have been used with great success in the treatment of cancer . . . . In view of the success of this class of drugs, it has been argued that microtubules represent the best cancer target to be identified so far . . . ."

[0103] The polymerization dynamics of microtubules are discussed at pages 254 et seq. of the Jordan paper, wherein it is disclosed that: "The polymerization if microtubules occurs by a nucleation-elongation mechanism in which the relatively slow formation of a short microtubule `nucleus` is followed by rapid elongation of the microtubule at its ends by the reversible, non-covalent addition of tubulin dimers . . . . It is important to emphasize that microtubues are not simple equilibrium polymers. The show complex polymerization dynamics that use energy provided by the hydrolysis of GTP at the time that tubulin with bound GTP adds to the microtubule ends; these dynamics are crucial to their cellular functions."

[0104] The Jordan et al. article also disloses that: " . . . the correct movements of the chromosomes and their proper segregation to daughter cells require extremely rapid dynamics, making mitosis exquisitely sensitive to microtubule-targeted drugs."

[0105] The Jordan et al. article also disloses that: "The biological functions of microtubules in all cells are determined and regulated in large part by their polymerization dynamics . . . . Microtubules show two kinds of non-equilibrium dynamics, both with purified microtubule systes in vitro and in cells."

[0106] The Jordan et al. article also discloses (at page 257, "Box 1") how one may measure microtubule dynamic instability. It states that:"With purified microtubules in vitro (generally purified from pig, cow, or sheep brains, which are a rich source of microtubules), dynamic instability of individual microtubules is measured by computer-enhanced time-lapse differential interference contrast microscopy. In living cells, individual fluorescent microtubules can be readily visualized in the thin peripheral regions of the cells after microinjection of fluorescent tubulin or by expressnion of GFP (green fluorescent protein) labeled tubulin. The growing and shortening dynamics of the microtubules, which are prominent in this region of interphase cells, are recorded by time-lapse using a sensitive CCD (charge-coupled device) camera. To determine how microtubule length changes with time, both in vitro and in living cells, the ends of the individual growing and shortening microtubules are traced by a cursor on succeeding time-lapse frames, recorded, and their rates, lengths, and durations of growing and shortening are calculated from the sequence of record x-=y positons of the microtubule ends."

[0107] The "dynamic instability" phenomenon is discussed at page 254 of the Jordan et al. article, wherein it is disclosed that: "One kind of dynamic behavior that is highly prominent in cells, called `dynamic instability,` is a process in which the individual microtubule ends switch between phases of growth and shortening . . . . The two ends of a microtubule are not equivalent: one end, called the plus end, grows and shortens more rapidly and more extensivelythan the other (the minus end) . . . . The microtubules undergo relatively long periods of slow lengthening, brief periods of rapid shortening, and periods of attenuated dynamics or pause, when the microtubules neither gorw nor shorten detectably . . . . Dynamic instability is characterized by four main variables: the rate of microtubule growth; the rate of shortening; the frequency of transition from the growth or paused state to shortening (this transitionis called a `catastrophe`); and the frequency of transition from shortening to growth or pause (called a `rescue`). Periods of pause are defined operationally, when any changes in microtubule length that might be occurring are below the resolution of the light microscope. The variable called `dynamicity` is highly useful to describve the overall visually detectable rate of exchange of tubulin dimmers with microtubule ends."

[0108] The Jordan et al. article also discloses that: "The second dynamic behavior, called `treadmilling` . . . is net growth at one microtubule end and balanced net shortening at the opposite end . . . . It involves the intrinsic flow of tubulin subunits from the plus end of the microtubule to the minus end and is created by differences in the critical subunit concentrations at the opposite microtubule ends. (The critical subunit concentrations are the concentrations of the free tubulin subunits in equilibrium with the microtubule ends.). This behavior occurs in cells as well as in vitro and might be particularly important in mitosis . . . . Treadmilling and dynamic instability are compatible behaviours, and a specific microtubule population can show primary treadmilling behavior, dynamic instability behaviour, or some mixture of both. The mechanisms that control one or the other behavior are poorly understood but probably involve the tubulin isotype compositon of the microtubule poplulation, the degree of post-transaltional modification of tubulin, and, especially, the actions of regulatory proteins." Applicants believe that, by causing the combination of one or more particular tubulin isotypes with a candidate therapeutic agent, one may affect the treadmiling behaviour and/or the dynamic instability behaviour of the microtubules which comrprise the tubulin isotype." In particular, they believe that the magnetic anti-mitotic compound of their invention affects the treadmilling behavior and/or the dynamic instability behavior of microtubules.

[0109] As is disclosed on page 263 of the Jordan et al. article, a comprehensive review of tubulin isotypes and post-translational modifications is presented in an article by R. F. Luduena, "Multiple forms of tubulin: different gene productrs and covalent modifications," Int. Rev. Cytology, 170: 207-275 (1998). The Jordan et al. article also refers to a work by P. Verdier-Pinard et al., "Direct analysis of tubulin expression in cancer cell lines by electrospray ionization mass spectrometery," Biochemistry, 42: 12019-12027 (2003). According to the Jordan et al. article, "The Verider-Pinard et al. article describes analyses of tubulin isotypes, muations, and post-translational modifications by liquid chromatography/electrospray-ionization mass spectrometery in paclitaxel-sensivite and resistant cell lines."

[0110] Referring again to the Jordan et al. article, it is disclosed that: "Dynamic instability and treadmilling behaviours can both be observed with purified microtubules in vitro. However, the rate and extent of both treadmilling and dynamc instability are relatively slow with purified microtubules compared with rates in cells. It is clear that microtubule dynamics in cells are regulated by a host of mechanisms: cells can alter their expression levels of 13 tubulin isotypes; they can alter their levels of tubulin post-translational modifications; they can express mutated tubulin; and they can alter the expression and phosphorylation levels of microtubule-regulatory proteins . . . that interact with the microtubule surfaceds and ends. Although microtubule dynamics can be modulated by the interaction of regulatory molecules with soluble tubulin itself, the assembled microtubule is likely to the the primary target of cellular molecules that regulate microtubule dynamics. The many drugs that modulate microtubule dynamics might be mimicking the actions of the numerous natural regulators that control microtubule dynamics in cells." Applicants believe that the magnetic anti-mitotic compound of their invention is as effective as is paclitaxel in " . . . mimicking the actions of the numerous natural regulators that control microtubule dynamics in cells . . . ."

[0111] At page 255 of the Jordan et al. article, the authors disclose that "Microtubule dynamics are crucial to mitosis . . . . With the development of sophisticated methods for observing microtubule dynamics in living cells, it is now possible to visualize the dynamics of mitotic spindle microtubules. With these advances it has become clear that microtubles in mitotic spindles have uniquely rapid dynamics that are crucial to successful mitosis . . . . During interphase, microtubules turn over (eschange their tubulin with the soluble tubulin pool) relatively slowly, with half-times that range from several minutes to several hours . . . . The interphase microtubule network disassembles at the onset of mitosis and is replaced by a new population of spindle microtubules that are 4-100 times more dynamic than the microtubules in the interphase cytoskeleton. Although there is variation among the various spindle-microtubule subpopulations, mitotic-spindle microtubules exchange their tubulin with tubulin in the soluble pool rapidly with half-times on the order of 10-30 seconds . . . . At least in some cells, the increase in dynamics seems to result from an increase in the catastrophe frequency, and a reduction in the rescue frequency rather than from changes in the inherent rate of growth and shortening."

[0112] At page 256 of the Jordan et al. article, a "Table 1" is presented regarding "Antimitotic drugs, their diverse binding sites on tubulin and their stages of clinical development." As is disclosed in such Table 1, one of the well-known binding domains on tubulin is the "vinca domain."

[0113] One drug that binds at the vinca domain is Vinblastine (Velban), which is used to treat Hodgkins disease and testicular germ cell cancer. Reference may be had, e.g., to articles by G. C. Na et al. ("Thermodynamic linkage between tubulin self-association and the binding of vinblastine," Biochemistry, 19: 1347-1354, 1980; and "Stoichiometry of the vinblastine self-induced self-association of calf-brain tubulin," Biochem. Soc. Trans., 8: 1347-1354, 1980), by S. Lobert et al. (in Methods in Enzymology, Vol. 323, [ed. Johnson M.] 77-103 [Academic Press 2000]), and by A.Duflos et al. ("Novel aspects of natural and modified vinca alkaloids," Curr. Med. Chem. Anti-Canc. Agents, 2: 55-70, 2002).

[0114] Another drug that binds at the vinca domain is Vincristine (Oncovin); it is used to treat leukemia and lymphomas. Reference may be had, e.g., to works by G. L. Plosker et al. ("Rituximab: a review of its use in non-Hodgkins lymphoma and chronic leukemia," Drugs, 63: 803-843, 2003), by A. B. Sandler ("Chemotherapy for small cell lung cancer," Semin. Oncol., 30: 9-25, 2003), and by J. O. Armitage et al. ("Overview of rational and individualized therapeutic strategies for non-Hodgkin's lymphoma," Clin. Lymphoma, 3: S5-S11, 2002).

[0115] Another drug that binds at the vinca domain is Vinorelbine (Navelbine), which is used to treat sold tumors, lymphomas and lung cancer. Reference may be had, e.g., to works by J. Jassem et al. ("Oral vinorelbine in combination with cisplatin, a novel active regimen in advanced non-small-cell lung cancer," Ann. Oncol. 14: 1634-1639, 2003), by A. Rossi et al. ("Single agent vinorelbine as first-line chemotherapy in elderly patients with advanced breast cancer," Anticancer Res., 23: 1657-1664, 2003), and by A. D. Seidman ("Monotherapy options in the management of metastatic breast cancer," Semin. Oncol., 30: 6-10, 2003).

[0116] Another drug that binds at the vinca domain is Vinflnine, which is used to treat bladder cancer, non-small-cell lung cancer, and breast cancer. Reference may be had to, e.g., the aforementioned article by A. Duflos et al., and to an article by T. Okouneva et al. on "The effects of vinflunine, vinorelbine, and vinblastine on centromere dynamics," Cancer Ther., 2: 4.27-4.36, 2003.

[0117] Another drug that binds to the vinca domain is cryptophycin 52, and it is used to treat solid tumors. Reference may be had, e.g., to articles by D. Panda et al. ("Interaction of the antitumor compound cryptophycin 52 with tubulin," Biochemistry, 39: 14121-14127, 2000), and by K. Kerksiek et al. ("Interaction of cryptophycin with tubulin and microtubules," FEBS Lett., 377: 59-61, 1995).

[0118] A class of drugs that binds to the vinca domain of tubulin is the halichondrins (such as, e.g., E7389). Reference may be had, e.g., to articles by M. A. Jordan ("Mechanism of action of antitumor drugs that interact with microtubules and tubulin," Curr. Med. Chem Anti-Cancer. Agents, 2: 1-17, 2002), by R. B. Bai et al. ("Halichondrin B and homohalichondrin B, marine natural products binding in the Vinca domain of tubulin. Discovery of tubulin-based mechanism of action by analysis of differential cytotoxity data," J. Biol. Chem., 266: 15882-15889, 1991), by R. F. Luduena et al. ("Interaction of halichondrin B and homohalichondrin B with bovine brain tubulin," Biochem. Pharmcol., 45: 4.21-4:27, 1993), and by M. J. Towle et al. (in in vitro and in vivo anticancer activities of synthetic macrocyclic ketone analogs of halichondrin B, Cancer Res., 61: 1013-1021, 2001).

[0119] Another class of drugs that bind to the vinca domain are the dolastatins (such as TZT-1027), which are used as a vascular targeting agent. Reference may be had, e.g., to an article by E. Harnel, "Natural products which interact with tubulin in the Vinca domain: maytarsine, rhizoxin, phomopsin A. Dolostatins 10 and 15 and halichondrin B.," Pharmacol. Ther., 55:31-51, 1992.

[0120] Another class of drugs that bind to the vinca domain is the hemiasterlins (such as HTI-286). Reference may be had, e.g., to articles by R. Bai et al. ("Interactions of the sponge-derived antimitotic antipeptide hemiasterin with tubulin: comparison with dolastatin 10 and cryptophycin 1," Biochemistry, 38: 14302-14310, 1999), and by F. Loganzo et al. ("HTI-286, a synthetic analogue of the tripeptide hemiasterin, is a potent antimicrotubule agent that circumvents P-glycoprotein-mediated resistance in vitro and in vivo," Cancer Res., 63: 1838-1845, 2003).

[0121] Another of the binding sites mentioned in the 2004 Jordan et al. article (see Table 1) is the colchicine domain. One of the drugs that binds in the colchicine domain is colchicine, and it is used to treat non-neoplastic diseases such as gout and familial Mediterranean fever. Reference may be had, e.g., to articles by S. B. Hastie ("Interactions of colchicines with tubulin," Pharmacol. Ther., 512: 377-401, 1991), and by D. Skoufias et al., "Mechanism of inhibition of microtubule polymerization by colchicines inhibitory potencies of unliganded cochicine and tubulin-colchicine complexes," Biochemistry, 31: 738-746, 1992.

[0122] The combretastatins (AVE8062A, CA-1-P, CA-4-P, N-acetylcolchicinol-O-phosphate, ZD6126) are another class of drugs that bind at the colchicines binding site. Reference may be had to articles by G. M. Tozer et al. ("The biology of the combretastatins as tumor vascular targeting agent," Int. J. Exp. Pathol., 83: 21-38, 2002), and by E. Harnel et al. ("Antitumor 2,3-dihydro-2-(aryl)-4(1H) quinazolinone derivatives: interactions with tubulin," Biochem. Pharmacol., 51: 53-59, 1996).

[0123] Another class of drugs that bind to the colchicines domain is the methoxybenzene-sulphonamides (such as ABT-751, E7010, etc.) that are used to treat solid tumors. Reference may be had, e.g., to an article by K. Yoshimatsu et al., "Mechanism of action of E7010, an orally active sulfonamide antitumor agent: inhibition of mitosis by binding to the colchicines site of tubulin," Cancer Res., 57: 3208-3213, 1997).

[0124] As is also disclosed in Table 1 of the 2004 M. A. Jordan et al. article, the taxane site is another well known tubulin binding site. Taxanes (such as paclitaxel) bind at this site and are used to treat ovarian cancer, breast cancer, lung cancer, Kaposi's sarcoma, and many other tumors. Reference may be had, e.g., to articles by S. B. Horwitz ("How to make taxol from scratch," Nature, 367: 593-594, 1994), by J. Manfredi et al.("Taxol binds to cell microtubules," J. Cell. Biol., 94: 688-696, 1982), by J. Parness et al. ("Taxol binds to polymerized tublulin in vitro," J. Cell. Biol., 91: 479-487, 1981), and by J. F. Diaz et al. ("Assembly of purified GDP-tubulin into microtubules induced by taxol and taxotere: reversibility, ligand stoichiochemistry, and competition," Biochemistry, 32: 2747-2755, 1993.).

[0125] Docetaxel (Taxotere) is another drug that binds to the taxane site; and it is used to treat prostrate, brain, and lung tumors. Reference may be had, e.g., to articles by C. P. Belani et al.("TAX 326 Study Group: First-line chemotherapy for NSCLC: an overview of relevant trials," Lung Cancer, 38 (Suppl. 4): 13-19, 2002), and by F. V. Fosella et al. ("Second line chemotherapy for NSCLC: establishing a gold standard," Lung Cancer, 38, 5-12, 2002).

[0126] The epothilones (such as BMS-247550, epothilones B and D) are other drugs that bind to the taxane site; they are used to treat paclitaxel-resistant tumors. References may be had, e.g., to articles by D. M. Bolag et al. ("Epothilones: a new class of microtubule-stabilizing agents with a taxol-like mechanism of action," Cancer Res., 55: 2325-2333, 1995), by M. Wartmann et al. ("The biology and medicinal chemistiry of epothilones," Curr. Med. Chem. Anti-Cancer Agents, 2: 123-148, 2002), by F. Y. Lee et al.("BMS-247550: a novel epothilone analog with a mode of action similar to apcitaxel but possessing superior antitumour efficacy," Clin. Cancer Res., 7: 1429-1437, 2001), and by K. Kamath et al. ("Suppression of microtubule dynamics by epothilone B in living MCF7 cells," Cancer Res., 63: 6026-6031, 2003).

[0127] There are other microtubule binding sites disclosed in Table 1 of the 2004 Jordan et al. publication. Thus, e.g., it is disclosed that estramustine is used to treat prostrate cancer. Reference may be had, e.g., to articles by D. Panda et al. ("Stabilizatio of microtubule dynamics by estramustine by binding to a novel site in tubulin: a possible mechanistic basis forits antitumor action," Proc. Nat. Acad. Sci USA94: 10560-10564,1997), by O. Smaletz et al. ("Pilot study of epothilone B analog [BMS-247550] and estramustine phosphate in patients with progressive metastatic prostrate cancer following castration," Ann. Oncol., 14: 1518-1524), by W. Kelly et al. ("Dose escalation study of intraveneous extramstine phosphate in combination with Paclitaxel and Carboplatin in patients with advanced prostate cancer," Clin. Cancer Res. 9: 2098-2107, 2003), by G. Hudes et al. ("Phase 1 clinical and pharmacologic trial of intraveneous estramustine phosphate," J. Clin. Oncol., 20: 1115-1127, 2002), and by B. Dahllof et al. ("Estramustine depolymerizes microtubules by binding to tubulin," Cancer Res. 53, 4573-4581, 1993).

[0128] Referring again to the Jordan et al. article, and at page 256 thereof, the criticality of "highly dynamic microtubules" is discussed. It is disclosed that: "Mitosis in most cells progresses rapidly and the highly dynamic microtubules in the spindle are required for all stages of mitosis. First, for the timely and correct attachment of chromosomes at their kinetochoares to the spindle during prometaphase after nuclear-envelope breakdown . . . . Second, for the complex movements of the chromosomes that bring them to their properly aligned positons at the metaphase plate . . . . Last, for the synchronous separation of the chromosomes in anaphase and telophase after the metaphase . . . . During prometaphase, microtubules emanating from each of the two spindle poles make vast growing and shortening excursions, essentially probing the cytoplasm until they `find` and become attached to chromosomes at their kinetocores . . . . Such microtubules must be able to grow for long distances . . . then shorten almost completely, then re-grow again, until they successfully become attached. The presence of a single chromosome that is unable to achieve a bipolar attachment to the spindle is sufficient to prevent a cell from transitioning to anaphase; the cell then remains blocked in a prometaphase/metaphase like state and eventually undergoes apoptosis (programmed cell death) . . . . We have found that suppression of microtubule dynamics by drugs such as paclitaxel (Taxol) and Vinca alkaloids seems to be a common mechanism by which these drugs block mitosis and kill tumour cells. Human osterosarcoma cells after inclubation with . . . paclitaxel and . . . vinflunine are shown . . . . Many chromosomes are stuck at the spindle poles, unable to congress to the metaphase plate. At least one reason that cancer cells are relatively sensitive to these drugus compared to normal cells is that cancer cells divide more freuqenlty than normal cells and thereofore frequently pass though a stage of vulnerability to mitotic poisons."

[0129] The anti-mitotic drugs may also interfere with "oscillations." As is disclosed at page 257 of the Jordan et al. article, "During metaphase in the absence of drugs . . . the duplicated chromosomes, which are attached to the microtubules at their kinetohores, oscillate back and forth under high tension in the spindle equatorial region in concert with growth and shortening of the attached microtubles . . . . Superimposed on these oscillations, tubulin is continuously and rapidly added to microtubles at the kinetochores and is lost at the poles in a balanced fashion(that is, the microtubules treadmill) . . . . The oscillations are believed to be required for th proper functioning of the spindle. The absence of tension on the chromosomal kinetochores is also sufficient to block cell-cycle progress from metaphase to anaphase . . . . In apanphase . . . , microtubules that are attached to chromosomes must undergo a carefully regulated shortening at that same time that another propotion of spindle microtubles (the interpolar microtubules) lengthens."

[0130] Anti-mitotic drugs interfere with these "microtubule dynamics" in different ways. As is disclosed at page 257 of the Jordan et al. article, " . . . a large number of chemically diverse substances bind to soluble tubulin and/or directly to tubulin in the microtubules." In one embodiment, the magnetic anti-mitotic drugs of this invention bind directly to soluble tubulin. In another embodiment, the magnetic anti-mitotic drugs of this invention binid to the polymerized tubulin in the microtubules.

[0131] As is also disclosed in the Jordan et al. article, "Most of these compounds are antimitotic agents and inhibit cell proliferation by actring on the polymerization dynamics of spindle microtubles, the rapid dynamics of which are essential to proper spindle function." In one embodiment, the magnetic anti-mitotic compounds of this invention act on the polymerization dynamics of the spindle microtubules.

[0132] As is also disclosed in the Jordan et al. article, "The specific effects of individual microtubule-targeted drugs on the microtubule polymer mass and on the stability and dynamics of the microtubules are complex. Microtubule-targeted antimitoitic drugs are usually classified into two main groups. One group, known as the microtubule-destabilizing agents, inhibits microtubule polymerization at high concentrations . . . ." In one embodiment, the magnetic anti-mitotic compounds of this invention inihibit microtubule polymerization at high concentrations.

[0133] As is also disclosed in the Jordan et al. article, "The second main group is known as the microtubule stabilizing agents. These agents stimulate microtubule polymerization and include paclitaxel . . . docetaxel . . . the epothilones, discodermolide . . . and certain steroids . . . ." In one embodiment, the magnetic anti-mitotic compounds of this invention stimulate microtubule polymerization.

[0134] As is also disclosed in the Jordan et al. article, "The classification of drugs as microtubule `staiblizers` or `destabilizers` is overly simplistic . . . . The reason . . . is that drugs that increase or decrease microtubule polymerization at high concentrations powerfully suppress microtubule dynamics at 10-100 fold lower concentrations and, therefore, kinetically stabilize the microtubules, without changing the microtubule-polymer mass. In other words, the effects of the drugs on dynamics are often more powerful than their effects on polymer mass. It was previously thought that the effects of the two classes of drugs on microtubule-polymer mass were the most important actions resonsbile for their chemotherapeutic properties. However, the drugs would have to be given and maintained at very high dosage levels to act primarily and continuously on microtubule-polymer mass. It now seems that the most important action of these drugs is the suppression of spindle-microtubule dynamics, which results in the slowing or blocking of mitosis at the metaphase-anaphase transition and induction of apoptioic cell death." In one embodiment, the magnetic properties of applicants' anti-mitotic compounds result in the slowing or blocking of mitosis at the metaphase-anaphase transition.

[0135] As is also disclosed in the Jordan et al. article, "The microtubule-targeted drugs affect microtubule dynamics in several different ways. To suppress microtubule dynamics for a significant time, the drugs must bind to and act directly on the microtubule. For example, a drug that suppresses the shortening rate at microtubule ends must bind directly to the microtubule, either at its end or along its length . . . many drugs also act on soluble tubulin, and the relatively ability of a given drug to bind to soluble tubulin or directly to the microtubule, and the location of the specific binding site in tubulin and the microtubule, greatly affect the response of the microtubule system to the drug."

[0136] At page 258 of the Jordan et al. article, the mechanism by which Vinca alkaloids kills cancer cells is discussed. It is stated that: "Tubulin and microtubules are the main targets of the Vinca alkaloids . . . , which depolymerize microtubles and destroy mitotic spindles at high concentrations . . . , therefore leaving the dividing cancer cells blocked in mitosis with condensed chromosomes. At low but clinically relevant concentrations, vinbalstine does not depolymerize spindle microtubules, yet it powerfully blocks mitosis . . . and cells die by apoposis. Studies form our laboratory . . . indicate that the block is due to suppression of microtubule dynamics rther than microtubule depolymerization . . . . Vinblastine binds to the beta-submit of tublin dimmers at a distict region called the Vinca-binding domain. Various other novel chemotherapeutic drugs also bind at this domain . . . . The binding of vinblastine to sulbue tubulin is rapid ad reversible . . . . Importantly, binding of vinblastine induces a conformational change in tubulin in connection with tubulin self-association . . . . The ability of vinlastine to increase the affinity of tubulin for itself probably has a key role in the ability of the drug to stabilize microtubules kinetically."

[0137] The degree to which vinblastine binds to tubulin depends upon whether the tubulin is "exposed" or "buried." As is also disclosed in the Jordan et al. article, "Vinblastine also binds directly to microtubules. In vitro, vinblastine binds to tubulin at the extreme microtubule ends . . . with very high affinity, but it binds with markedly reduced affinity to tubulin that is brued in the tubulin lattice . . . . Remarkably, the binding of one or two molecules of vinblastine per microtubule plus end is sufficient to reduce both treadmilling and dynamic instability by about 50 percent without causing appreciable microtubule depolymerization."

[0138] By comparison, the taxanes bind poorly to soluble tubulin. As is also disclosed in the Jordan et al. article, "The taxanes bind poorly to soluble tubulin itself, but instead bind directly with high affinity to tubulin along the length of the microtubule . . . . The biding site for paclitaxel is in the beta-subunit, and its location, which is on the inside surface of the microtubule, is known with precision . . . . Paclitaxel is thought to gain access to its binding sites by diffusing through small openings in the microtubules or fluctuations in the microtubule lattice. Binding of paclitaxel to its site on the inside microtubule surface stalbilizes the microtubule and increases microtubule polymerization, presumably by inducing a conformational change in the tubulin that, by an unkown mechanism, increases its affinity for neighboring tubulin molecules." In one preferred embodiment of this invention, a preferred magnetic anti-mitotic compound of the invention binds well to soluble tubulin.

[0139] Even relatlively small amounts of paclitaxel will stabilize the microtubules. As is disclosed in the Jordan et al. article, "There is one paclitaxel binding site on very molecule of tublin in a microtubule and the ability of paclitaxel to increase microtubule polymerization is associated with nearly 1:1 stoichiometric bind of paclitaxel to tubulin in microtubules So if a typical microtubule consists of approximately 10,000 tubulin molecules, then the ability of paclitaxel to increase microtubule polymerization requires the binding of about 5,000 packlitaxel molecules per microtubule. However, in contrast with the large number of molecules that are required to increase microtubule polymerization, we found that binding of a very small number of molecules stabilizes the dynamics of the microtubules without increasing microtubule polymerization." Support for this statement in the article was a work by W. B. Derry et al., "Substoichiometric binding of taxol suppresses microtubule dynamics," Biochemistry, 34: 2203-2211, 1995.

[0140] As is also disclosed in the Jordan et al. article, " . . . just one paclitaxel molecule bound per several hundred tubulin molecules in a microtubule can reduce the rate of microtubule shortening by about 50 percent. Suppression of microtubule dynamics by paclitaxel leads to mitotic block in the absence of significant microtubule bundling." Basis for this statement was an article by A. M. Yvon et al., "Taxol suppresses dynamics of individual microtubules in living human tumor cells," Mol. Biol. Cell, 10:947-949, 1999. This Yvon et al. artricle was the "first demonstration that suppression of microtubule dynamics in living cells by low concentrations of paclitaxel correlates with mitotic block."

[0141] As is also disclosed in the Jordan et al. article, " . . . the suppression of spindle-microtubule dynamics prevents the dividing cancer cells from progressing from metaphase into anaphase and the cells eventually die by apoptosis." As basis for this statement, articles were cited by M. A. Jordan et al. ("Mitotic block induced in HeLa cells by low concentrations of paclitaxel [Taxol] results in abnormal mitotic exit and apoptotic cell death," Cancer Res., 56: 816-825, 1996), by Yvon et al. ("Taxol suppresses dynamics of individual microtubules in living human tumor cells, Mol. Biol. Cell, 10: 947-949, 1999), and by J. Kelling et al. ("Suppression of centromere dynamics by taxol in Iving osteosarcoma cells," Cancer Res., 63: 2794-2801, 2003).

[0142] The Jordan et al. article also discusses the mechanism by which colchicines exerts its anti-mitotic effects. At pages 260 et seq., it discloses that: "The interaction of colchicines with tubulin and microtubules presents yet another variation in the mechanisms by which microtubule-active drugs inhibit microtubule function. As with the Vinca alkaloids, colchicines depolymerizes microtubles at high concentrations and stabilizes microtubule dynamics at low concentrations. Colchicine inhibits microtubule polymerization substoichiometrically (at concentrations well below the concentration of tubulin that is free in solution . . . ." In support of this statement, the Jordan et al. article cites an article by L. Wilson et al. (in Microtubules [eds. J. S. Hymans et al.], 59-84 [Wiley-Liss, New York, N.Y., 1994]).

[0143] As is also disclosed in the Jordan et al. article, " . . . colchicine itself does not bind directly to microtubule ends. Instead, it first binds to soluble tubulin, induces slow conformational changes in the tubulin and ultimately forms a poorly reversible final state tubulin-colchicine complex . . . which then copolymerizes into the microtubule ends in small numbers along with large numbers of free tubulin molecules."

[0144] The Jordan et al. article discloses that the tubulin-colchicine complexes must bind more tightly to tublin that tubulin itself does, stating that: "Tubulin colchicines complexes might have a conformation that disrupts the microtubule lattice in a way that slows, but does not prevent, new tubulin addition. Importantly, the incorporated tubulin-colchicine complex must bind more tightly to its tubulin neighbors than tubulin itself does, so that the normal rate of tubulin dissociation is reduced."

[0145] As is also disclosed in the Jordan et al. article, "So, despite the differences between the effects at high concentrations of the Vinca/colchicines-like drugs and the taxane-like drugs, nearly all of the microtubule-targeted antimitotic drugs stabilize microtubule dynamics at their lowest effective concentrations. Stabilization of microtubule dynamics correlates with blocking of the cell cycle at mitosis and in senstivie tumour cells, ultimately resulting in cell death by apoptosis. Therefore, the most potent mechanism of nearly all of the microtubule -targeted drugs seems to be the stabilization of dynamics of mitotic spindle microtubles."

[0146] In one preferred embodiment of this invention, the antimitotic compounds of this invention inhibit the process of angiogenesis (the formation of new blood vessels). In another embodiment of this invention, the antimitotic compounds of this invention shut down the existing vasulature of tumors.

[0147] Prior art compositions that have these antivascular effects have been reported. Thus, as is disclosed at page 260 of the 2004 Jordan et al. article, ""The tumour vasculature is a relatively attractive new target for cancer therapy. The vasculature is easily accessible to blood-borne therapeutic agents, and tumour cells generally die rapidly unless they are supplied with oxygen and nutrients through the blood. There are two types of approaches to inhibiting vascular function. One . . . is the search for agents that inhibit the process of angiogenesis-the formation new blood vessels. However, more recently, the ability of several compounds, especially microtubule-targeted agents, to rapidly shout down existing turmour vasculature has been recognized . . . ." In support of this last statement, the Jordan et al. article cited an article by G. M. Tozer et al. on "The biologcy of the combretastatins as tumouor vascular targeting agents," Int. J. Exp. Pathol., 83: 21-38 (2002).

[0148] As is also disclosed in the 2004 Jordan et al. article, "Since the late 1990s, the combestatins and N-acetylcolchicinol-O-phosphate, compounds that resemble colchicines and bind to the colchicines domain on tubulin, have undergone extensive development as antivascular agents . . . . When vascular targeting agents . . . are added to cultures of endothelial cells . . . , the microtubules rapidly depolymerize, the cells become round within minutes, undergo blebbing and detaching from the substrate, actin stress fibres form (presumably as a result of signaling from the depolymerizing microtubule cytoskeleton), and the cells die with no evidence of apoptosis." As support for this latter statement, the 2004 Jordan et al. article cited a work by C. Kanthou et al., "The tumor vascular targeting agent combretastatin A-4 phosphate induces reorganization of the actin cytoskeleton and early membrane blebbing in human endothelial cells," Blood, 99:2060-2069 (2002).

[0149] As is also disclosed in the 2004 Jordan et al. article, "The process of vascular shutdown can be observed in rats through windowed chambers that are implanted subcutaneously. This indicates that a primary and marked effect of vascular-targeting agents is an extremely rapid reduction of blood flow to the interior of solid tumours, often within 5 minutes of administering the drug to the aminal. Within 1 hour, the red-cell velocity might drop to less than 5 percent of the starting value." As support for this statement, the 2004 Jordan et al. article cited a work by G. M. Tozer et al. on "Mechanisms associated with tumor vascular shut-down induced by combretastatin A-4 phosphate: intravital miscroscopy and measurement of vascular permeability," Cancer Res., 61: 6413-6422 (2001).

[0150] The anti-vascular agents cause small blood vessels to disapper, blood flow to slow, red blood cells to aggregate in stacks or "rouleaux," hemorrhaging from peripheral tumor vessels to occur, vascular permeability to increase, and the death of interior tumor cells by necrosis. See, e.g., an article by G. M. Tozer et al., "The Biology of the combretastatins as tumor vascular targeting agents," Int. J. Exp. Pathol, 83: 21-38 (2002).

[0151] As is also disclosed in the 2004 Jordan et al. article, " . . . the vascular-targeting aents that are now under development seem to damage tumour vasculature without significantly harming normal tissues . . . ." The Jordan et al. article, as support for this statement, cites work by V. E. Prise et al., reported in "The vascular response of tumor and normal tissues in the rat to the vascular targeting agent combretastatin A4 phosphate, at clinically relevant doses," Int. J. Oncol. 21: 717-726 (2002). In one embodiment, the magnetic anti-mitotic compound of this invention damages tumors without significantly harming normal tissues.

[0152] As is also disclosed in the 2004 Jordan et al. article, "The source of this specificity is not known, but has been suggested to be attributable to differences between the mature vasculature of normal tissues and the immature or forming vasculature of tumors. There are suggestions that endothelial cells of immature vasculature could have a less well-developed actin cytoskeleton that might make the cells more susceptible to collapse." The basis for this statement was an article by P. D. Davis et al., "ZD6126: A novel vascular-targeting agent that casues selective destruction of tumor vasculature," Cancer Res. 62: 7247-7253 (2003).

[0153] As is also disclosed in the 2004 Jordan et al. article, " . . . more sluggish or more variable blood flow in tumour vasculature might make the tumour vessels particularly susceptible to damaging agents. Differences in rates of endothelial-cell proliferation, in post-translational modifications of tubulin, and in interactions between actin and microtubules might also contribute to the specificity of vasclualr targeting agents."

[0154] At page 261 of the 2004 Jordan et al. article, tumor sensitivity and resistance are discussed. It is disclosed that: "Among the most important unsolved questions about the antitumour activities of microtubule-targeted drugs concerns the basis of their tissue specificities and the basis for the development of drug resistance to these agents. For example, it is not known why paclitaxel is so effective against ovarian, mammary and lung tumours, but essentially ineffective against many other solid tumours, such as kidney or color carcinomas and various sarcomas. Similarly, for the Vinca alkaloids, it is unclear why they are frequently most effective against haematological cancers, but often ineffective against many solid tumors. There are clearly many determinants of sensitivity and resistance to antimitotic drugs, both at the level of the cells themselves and at the level of the pharmacological accessibility of the drugs to the tumour cells." As authority for these statements, the 2004 Jordan et al. article cited work by C. Dumontet et al., "Mechanisms of action of and resistance to antitubulin agents: microtubule dynamics, drug transport, and cell death," J. Clin. Oncol., 17: 1061-1070 (1999).

[0155] As is also disclosed in the 2004 Jordan et al. article, "the "ultimate failure or inherent resistance to chemotherapy with antimitotic drugs often results from overexpression of a class of membrane transporter proteins known as ABC-transporters(ATP-dependent drug efflux pumps or ATP-binding cassettes). These membrane pumps produce decreased intracellular drug levels and lead to cross-resistance (multidrug resistance) . . . to drugs of different chemical structures, such as paclitaxel and Vinca alkaloids. The first of many identified was P-glycoprotein, the product of the human MDRI gene." As support for these statements, the 2004 Jordan et al. article cited work by S. V. Ambudkar et al., "P-glycoprotein: from genomics to mechanism," Oncogene, 22: 7468-7485 (2003).

[0156] In one preferred embodiment, the magnetic anti-mitotic compound of this invention is not removed by these membrane pumps. It should be noted that, as is reported by the 2004 Jordan et al. article, "Considerable efforts are underway to understand these mechanisms of resitance, to develop P-glycoprotein inhibitors and to develop microtubule-targeted drugs that are not removed by these pumps. As authority for these statements, the 2004 Jordan et al. article cited works by S. V. Ambdukar et al. (see the citation in the preceding paragraph), by A. R. Safa ("Identification and characterization of the binding sites of P-glycoprotein for multidrug-resistance-related drugs and modulators," Curr. Med. chem. Anti-Canc. Agents, 4: 1-17, 2004), by H. Thomas et al. ("Overcoming multidrug resistance in ancer: an udate on the clinical strategy of inhibiting P-glycoprotein," Cancer Control, 10: 159-165, 2003), and by R. Geney et al. ("Overcoming multidrug resistance in taxane chemotherapy," Clin. Chem. Lab. Med., 40: 918-925, 2002).

[0157] The 2004 Jordan et al. article discusses the role of specific tubulin isotypes in multidrug resitance. At page 262 of the article, it is stated that: "However, in addition, cells also have many microtubule-related mechanisms that confer resistance or determine intrinsic insensivity to antimitotic drugs." As support for these statements, the Jordan et al. article cites an article by G. A. Orr et al. ("Mechanisms of taxol resistance related to microtubules," Oncogene, 22: 7280-7295, 2003) which is a comprehensive review of microtubule-related mechanisms of paclitaxel resistance. The article also cites works by M. Kavallaris et al.("Multiple microtubule alterations are associated with Vinca alkaloid resistance in human leukemia cells," Cancer Res, 61: 5803-5809, 2001), by A. M. Minotti et al. ("Resistance to antimitotic drugs in Chinese hamster overay cells correlated with changes int eh level of polymerized tubulin," J. Biol. Chem., 266: 3987-3994, 1991), by S. W. James et al. (A mutation in the . . . tubulin gene of Chlamydomonas reinhardtii confers resistance to anti-microtubule herbicides," J. Cell Sci. 106: 209-218, 1993), by W. P. Lee et al. ("Purification and characterization of tublin form parental and vincristine-resistant HOB1 lymphoma cells," Arch. Biochem. Biophys. 319: 498-503, 1995), by S. Ohta et al. ("Characterization of a taxol-resistant human small-cell lung cancer cell line," Jpn. J. Cancer Res., 85: 290-297, 1994), and by N. M. Laing et al. ("Amplification of the ATP-binding cassette 2 transporter gene if unctionally linked with enhanced efflux of estramustine in overian carcinoma cells," Cancer Res., 58: 1332-1337, 1998.)

[0158] In one preferred embodiment of this invention, the magnetic anti-mitotic compound of this invention binds to, and inactivates, a tubulin isotype that causes, or tends to cause, drug-resistance.

[0159] As is also disclosed in the 2004 Jordan et al. article, "Microtubule polymer levels and dynamics are regulated by a host of factors, including expression of regulatory proteins, post-translational modifications of tubulin and extression of different tubulin isotypes. The levels of each of these isotpypes differ among tissue and cell types, and there are numerous examples of changes in their levels that correlate with development of resistance of paclitaxel or Vinca alkaloids and other microtubule-targeted drugs." In support of these statements, the Jordan et al. article cited works by C. M. Galmarini et al. ("Drug resistance associated with loss of p53 involves extensive alterations in microtubule composition and dynamics," Br. J. Cancer, 88:1793-1799, 2003), by C. A. Burkart et al. ("The role of beta-tubulin isotpyes in resistance to antimitotic drugs," Biochim. Biophys. Acta, 2: 01-09, 2001), by C. Dumontet et al. ("Resistance to microtubule-targeted cytotoxins in a K562 leukemia cell variant is associated with altered tubulin expression," Elec. J. Oncol., 2: 33-44, 1999), by P. Giannakakou et al. ("A common pharmacophore for epothilone and taxanes: molecular basis for drug resistance conferred by tubulin mutations in human cancer cells, Proc. Natl. Acad. Sci USA, 97: 2904-2090, 2000), by A. Goncalves et al. ("Resistance to taxol in lung cancer cells associated with increased microtubule dynamics," Proc. Natl. Acad. Sci USA, 98: 11737-11741, 2001), by M. Haber et al. ("Altered expression of M32, the class II beta-tubulin isotype, in a murine J774.2 cell line with a high level of taxol resistance," J. Biol. Chem., 270: 31269-31275, 1995), by J. P. Jaffrezou et al. ("Novel mechanism of resistance to paclitaxel in human K562 leukemia cells by combined selection with PSC833," Oncology Res., 7: 512-517, 1995), and by M. Kavallaris et al. ("Taxol-resistant epithelial ovarian tumors are associated with altered expression of specific beta-tubulin isotypes),: J. Clin. Invest. 100: 1-12, 1997. In one embodiment, the " . . . specific beta-tubulin isotypes" that are preferentially expressed by malignant cells are preferentially bound to (and inactivated) by the magnetic, anti-mitotic compound of this invention, as is more fully discussed elsewhere in this specification.

[0160] As is also disclosed in the 2004 Jordan et al. article, " . . . subtle suppression of microtubule dynamics by paclitaxel, vinblastine or other antimitotic drugs, without any attendant change in the microtubule-polymer mass, prevents progress through the cell cycle from metaphase to anaphase in sensitive cells. Changes in microtubule dynamics can lead to altered sensitivity to microtubule-targeted drugs. In one well studied case of paclitaxel resistance, resistant and paclitaxel-depedent A549 lung cancer cells had inherently faster microtubule dynamics following withdrawal of paclitaxel than sensitive cells . . . ." As support for this statement, the article cited work by A. Goncalves et al., reported in "Resistance to taxol in lung cancer cells associated with increased microtubule dynamics," Proc. Natl. Acad. Sci. USA, 98: 11737-11747, 2001."

[0161] As is also disclosed in the 2004 Jordan et al. article, "In the absence of paclitaxel, the paclitaxel-resistant/dependent cells with the faster microtubule dynamics were unable to progress from metaphase to anaphase and their spindles became disorganized. So, these cells were resistant to paclitaxel and also dependent on paclitaxel to slow their dynamics and allow them to go through mitosis successfully. The inherent sensititivy of cells to subtle changes in microtubule dynamics means that there are numerous ways for cells to become resistant to microtubule-targeted drugs. In the case of the paclitaxel-resistant A549 cells discussed above, the mechanisms of increased dynamics seem to involve several changes. The resistant cells overexpress one of the isotypes of tubulin, BIII-tubulin." As support for this last statement, the 2004 Jordan et al. article cited works by M. Kavallaris et al. ("Antisense oligonucleotides to class III beta-tubulin sensitive drug-resistant cells to taxol," Br. J. Cancer, 80: 1020-1025, 1991), by L. A. Martello et al. ("Taxol and discodermolide represent a synergistic drug combination in human carcinoma cell lines," Clin. Cancer Res., 6: 1978-1987, 2000), and another article by Martello et al. ("Elevated levels of microtubule-destabilizing factors in a taxol-resistant A549 cell line with a alpha-tubulin mutation," Cancer Res., 63: 1207-1213, 2003. In one embodiment of this invention, the anti-mitotic compound of this invention is used to bind with, and inactivate, the beta-tubulin isotype(s) expressed by the drug-resistant cancer cells.

[0162] As is also disclosed in the 2004 Jordan et al. article. "In addition, they have a heterozygous point mutation in alpha-tubulin and they overexpress the ative form of the microtubule-destabilizing protein stahmin and the inactive form of the putative microtubule stabiling protein MAP 4 . . . ."

[0163] As is also disclosed in the 2004 Jordan et al. article, " . . . drug resistance might involve some of the ther forms of tubulin . . . that associate with the centrosomes in intrphase and with the spindle poles in mitotic cells." In one embodiment of this invention, the anti-mitotic compound of this invention binds to, and inactivates, one or more of these other forms of tubulin.

[0164] As is also disclosed in the 2004 Jordan et al. article. "The fact that antimitotic drugs bind to many diverse sites on tubulin and microtubles mean that clinical combinations of two or more of these drugs have the potential to improve efficiency and reduce the side effects of therapy." In one embodiment of this invention, the actions of two or more separate chemotherapeutic agents are combined into one compound or composition. In another embodiment, the anti-mitotic compound of this invention is administered with another chemotherapeutic agent, prior to the administration of another chemotherapeutic agent, or after the administration of another chemotherapeutic agent. This embodiment is discussed elsewhere in this specification.

[0165] As is also disclosed in the 2004 Jordan et al. article, "The discovery of the synergistm of paclitaxel with discodermolide is particularly interesting, as both drugs bind to the same or overlapping sites on tubulin or microtubules." In one embodiment, the magnetic, anti-mitotic compound of this invention binds to the same or averlapping sites on tubulin or microtubules as does paclitaxel.

[0166] Many of the matters disclosed in the 2004 Jordan et al. article regarding tubulin isotype are also disclosed in the patent literature.

[0167] By way of illustration, U.S. Pat. No. 5,888,818, the entire disclosure of which is hereby incorporated by reference into this specification, claims "An isolated DNA encoding an .alpha.- or .gamma.-tubulin, which tubulin is resistant to an anti-tubulin agent selected from the group consisting of dinitroanaline, phosphorothioamidate and chlorthal dimethyl, the resistant tubulin comprising a non-polar amino acid instead of a threonine residue at a position corresponding to that depicted as position 239, 237, or 240 in Table 2." At columns 1 et seq. of such patent, an excellent discussion of microtubules and tubulin isotypes is presented.

[0168] Thus, as is disclosed in U.S. Pat. No. 5,888,818, "Almost all eukaryotic cells contain microtubules which comprise a major component of the network of proteinaceous filaments known as the cytoskeleton. Microtubules thereby participate in the control of cell shape and intracellular transport. They are also the principal constituent of mitotic and meiotic spindles, cilia and flagella. In plants, microtubules have additional specialized roles in cell division and cell expansion during development."

[0169] As is also disclosed in U.S. Pat. No. 5,888,818, "In terms of their composition, microtubules are proteinaceous hollow rods with a diameter of approximately 24 nm and highly variable length. They are assembled from heterodimer subunits of an .alpha.-tubulin and a .beta.-tubulin polypeptide, each with a molecular weight of approximately 50,000. Both polypeptides are highly flexible globular proteins (approximately 445 amino acids), each with a predicted 25% .alpha. helical and 40% .beta.-pleated sheet content. In addition to the two major forms (.alpha.-and .beta.-tubulin), there is a rare .gamma.-tubulin form which does not appear to participate directly in the formation of microtubule structure, but rather it may function in the initiation of microtubule structure."

[0170] As is also disclosed in U.S. Pat. No. 5,888,818, "In all organisms, the multiple .alpha.- and .beta.-tubulin polypeptides are encoded by corresponding families of .alpha.- and .beta.-tubulin genes, which are located in the nuclear genome. Many such genes (or corresponding cDNAs) have been isolated and sequenced. For example, maize has approximately 6 .alpha.-tubulin genes and approximately 8 .beta.-tubulin genes dispersed over the genome (Villemur et al, 1992, 34th Maize Genetics Symposium). Some of the .alpha.-tubulin genes from maize have been cloned and sequenced (Montoliu et al, 1989, Plant Mol Biol, 14, 1-15; Montoliu et al, 1990, Gene, 94, 201-207; Villemur et al, 1992, J Mol Biol, 227:81-96), as have some of the .beta.-tubulin genes (Hussey et al, 1990, Plant Mol Biol, 15, 957-972). Comparison of amino acid sequences of the three documented maize .alpha.-tubulins indicates they have 93% homology. Maize .beta.-tubulins exhibit 38% identity with these .alpha.-tubulins. In segments of divergence between the .alpha.- and .beta.-tubulin amino acid sequences, homology ranges from 13% to 17%. Homology between the three .alpha.-tubulin amino acid sequences within these same .alpha.-/.beta.-divergence regions ranges from 77% to 96%."

[0171] As is also disclosed in U.S. Pat. No. 5,888,818, "Sequence information on the various tubulin forms shows that throughout evolution the protein domains involved in polymerization have been highly conserved, and interspecies amino acid sequence homology is generally high. For example, the four .beta.-tubulin isotypes in human are identical with their counterparts in mouse. There is 82-90% homology between mammalian neuronal or constitutively expressed tubulins and algal, protozoan and slime mould tubulins. Considering plant sequences in more detail, there are long stretches in which the amino acid sequence of all the .alpha.- and .beta.-tubulins are identical (Silflow et al, 1987, Developmental Genetics, 8, 435-460). For example, the 35 amino acids in positions 401-435 are identical in all plant .alpha.-tubulins, as are the 41 amino acids in the region between positions 240 and 281 in the plant .beta.-tubulins. Conservation of amino acid residues is approximately 40% between the .alpha.- and .beta.-tubulin families, and 85-90% within each of the .alpha.- and .beta.-tubulin families. It should be noted that in general, most .alpha.-tubulins are 1 to 5 residues larger that the .beta.-tubulins."

[0172] U.S. Pat. No. 5,888,818 then goes on to discuss anti-tubulin agents, stating that: "The economic interest of tubulins lies in the effect of certain agents which interfere with tubulin structure and/or function. Such agents (including non-chemical stresses) are hereinafter referred to as `anti-tubulin agents` as they share a similar type of mode of action. Extreme conditions are known to destabilize the tubulins and/or microtubules. Such conditions include cold, pressure and certain chemicals. For example, Correia (1991, Pharmac Ther, 52:127-147) describes .alpha.- and .beta.-tubulin interactions, microtubule assembly and drugs affecting their stability. Some anti-tubulin agents are often called `spindle poisons` or `antimitotic agents` because they cause disassembly of microtubules which constitute the mitotic spindle. For at least one hundred years, it has been known that certain chemical agents arrest mammalian cells in mitosis, and of these agents the best known is colchicine which was shown in the mid-1960s to inhibit mitosis by binding to tubulin. Many of these anti-tubulin agents have since found widespread use as cancer therapeutic agents (eg vincristine, vinblastine, podophyllotoxin), estrogenic drugs, anti-fungal agents (eg griseofulvin), antihelminthics (eg the benzimidazoles) and herbicides (eg the dinitroanilines). Indeed some of the specific agents have uses against more than one class of organism. For example, the dinitroaniline herbicide trifluralin has recently been shown to inhibit the proliferation and differentiation of the parasitic protozoan Leishmania (Chan and Fong, 1990, Science, 249:924-926)." Thus, as is apparent from this teaching, the magnetic, anti-mitotic drugs disclosed in this specification may be used not only to treat cancer but also as " . . . estrogenic drugs, anti-fungal agents . . . , antihelminthics . . . and herbicides . . . ."

[0173] As is also disclosed in U.S. Pat. No. 5,888,818, "The dinitroaniline herbicides may be considered as an example of one group of anti-tubulin agents. Dinitroaniline herbicides are widely used to control weeds in arable crops, primarily for grass control in dicotyledonous crops such as cotton and soya. Such herbicides include trifluralin, oryzalin, pendimethalin, ethalfluralin and others. The herbicidally active members of the dinitroaniline family exhibit a common mode of action on susceptible plants. For example, dinitroaniline herbicides disrupt the mitotic spindle in the meristems of susceptible plants, and thereby prevent shoot and root elongation (Vaughn K C and Lehnen L P, 1991, Weed Sci, 39:450-457). The molecular target for dinitroaniline herbicides is believed to be tubulin proteins which are the principle constituents of microtubules (Strachan and Hess, 1983, Pestic Biochem Physiology, 20, 141-150; Morejohn et al, 1987, Planta, 172, 252-264)."

[0174] As is also disclosed in U.S. Pat. No. 5,888,818, "The extensive interest in anti-tubulin agents in many branches of science has been accompanied by the identification of several mutants shown to resist the action of such agents (Oakley B R, 1985, Can J Blochem Cell Biol, 63:479-488). Several of these mutants have been shown to contain modified .alpha.- or .beta.-tubulin genes, but to date the only resistant mutants to be fully characterised and sequenced are those in .beta.-tubulin. For example, colchicine resistance in mammalian cell lines is closely associated with modified .beta.-tubulin polypeptides (Cabral et al, 1980, Cell, 20, 29-36); resistance to benzimidazole fungicides has been attributed to a modified .beta.-tubulin gene, for example in yeast (Thomas et al, 1985, Genetics, 112, 715-734) and Aspergillus (Jung et al, 1992, Cell Motility and the Cytoskeleton, 22:170-174); some benzimidazole resistant forms of nematode are known; and dinitroaniline-resistant Chlamydomonas mutants possess a modified .beta.-tubulin gene (Lee and Huang, 1990, Plant Cell, 2, 1051-1057). Some of these mutants, although resistant to one anti-tubulin agent, also show increased susceptibility to other anti-tubulin agents (such as cold stress)." As is also discussed elsewhere in this, and in one preferred embodiment, the anti-mitotic compounds and/or compositions of this invention are adapted to bind one or more of the tubulin isotypes expressed by such mutants.

[0175] As is also disclosed in U.S. Pat. No. 5,888,818, "Among certain weed species, some biotypes have evolved resistance to dinitroaniline herbicides. Three examples of species in which dinitroaniline resistant (R) biotypes have emerged are goosegrass, Eleusine indica (Mudge et al, 1984, Weed Sci, 32, 591-594); green foxtail, Setaria viridis (Morrison et al, 1989, Weed Technol, 3, 554-551); and Amaranthus palmeri (Gossett et al, 1992, Weed Technology, 6:587-591). These resistant (R) biotypes emerged following selective pressure exerted by repeated application of trifluralin. A range of resistant biotypes of each species exists but the nature and source of the resistance trait is unclear and the biotypes are genetically undefined. The R biotypes of these species exhibit cross-resistance to a wide range of dinitroaniline herbicides, including oryzalin, pendimethalin and ethalfluralin. All dinitroaniline herbicides have a similar mode of action and are therefore believed to share a common target site. Many of the R biotypes are also cross-resistant to other herbicide groups such as the phosphorothioamidates, which include amiprophos-methyl and butamifos, or chlorthal-dimethyl. The phenomenon of cross-resistance exhibited by resistant biotypes strongly indicates that the herbicide resistance trait is a consequence of a modified target site. In addition, the resistant biotypes appear to have no competitive disadvantage as they grow vigorously and can withstand various stresses (such as cold)." To the extent that the drug resistant trait is " . . . a consequence of a modified target site . . . ," and in one preferred embodiment, the magnetic anti-mitotoic compounds of this invention are adapted to preferentially bind to such modified target site.

[0176] As is also disclosed in U.S. Pat. No. 5,888,818, "It has not been previously shown which specific gene is modified in Eleusine indica or Setaria viridis to confer the dinitroaniline resistance trait. Research by K. C. Vaughn and M. A. Vaughn (American Chemical Society Symposium Series, 1989, 364-375) showed an apparent alteration in the electrophoretic properties of .beta.-tubulin present in an R biotype of Eleusine indica, and suggested dinitroaniline resistance results from the presence of a modified .beta.-tubulin polypeptide. The results of recent work by Waldin, Ellis and Hussey (1992, Planta, 188:258-264) provide no evidence that dinitroaniline herbicide resistance is associated with an electrophoretically modified .beta.-tubulin polypeptide in the resistant biotypes of Eleusine indicaor Setaria viridis which were studied." In one preferred embodiment of this invention, the magnetic anti-mitotic agent of this invention is adapted to bind to a target site on a beta-tubulin polypeptide.

[0177] U.S. Pat. No. 6,306,615, the entire disclosure of which is hereby incorporated by reference into this specification, claims a detection method for identifying modified beta-tubulin isotypes. Thus, e.g., claim 17 of this patent discloses: "17. A method of monitoring the amount of a tubulin modified at a cysteine residue at amino acid position 239 in a patient treated with a sulfhydryl or a disulfide tubulin modifying agent, the method comprising the steps of: (a) providing a sample from the patient treated with the tubulin modifying agent; (b) contacting the sample with an antibody that specifically binds to the tubulin modified at a cysteine residue at amino acid position 239; and (c) determining the amount of the tubulin modified at a cysteine residue at amino acid position 239 in the patient sample by detecting the antibody and comparing the amount of antibody detected in the patient sample to a standard curve, thereby monitoring the amount of the tubulin modified at a cysteine residue at amino acid position 239 in the patient."

[0178] As is also disclosed in U.S. Pat. No. 6,306,615, "Microtubules are composed of .alpha./.beta.-tubulin heterodimers and constitute a crucial component of the cell cytoskeleton. Furthermore, microtubules play a pivotal role during cell division, in particular when the replicated chromosomes are separated during mitosis. Interference with the ability to form microtubules from .alpha./.beta.-tubulin heterodimeric subunits generally leads to cell cycle arrest. This event can, in certain cases, induce programmed cell death. Thus, natural products and organic compounds that interfere with microtubule formation have been used successfully as chemotherapeutic agents in the treatment of various human cancers."

[0179] As is also disclosed in U.S. Pat. No. 6,306,615, "Pentafluorophenylsulfonamidobenzenes and related sulfhydryl and disulfide modifying agents (see, e.g., compound 1; 2-fluoro-1-methoxy-4-pentafluorophenylsulfonamidobenzene; . . . prevent microtubule formation by selectively covalently modifying .beta.-tubulin. For example, compound 1 does not covalently modify all of the five known .beta.-tubulin isotypes. Instead, binding is restricted to those .beta.-tubulin isotypes that have a cysteine residue at amino acid position 239 in .beta.-tubulin. Such isotypes include beta-1, beta-2, and beta-4. The other two isotypes (beta-3 and beta-5) have a serine residue at this particular position (Shan et al., Proc. Nat'l Acad. Sci USA 96:5686-5691 (1999)). It is notable that no other cellular proteins are modified by compound 1." In one embodiment of this invention, the anti-mitotic compound of this invention selectively covalently modifies certain beta-tubulin isotypes but does not covalently modify other proteins.

[0180] U.S. Pat. No. 6,362,321. the entire disclosure of which is hereby incorporated by reference into this specification, discusses taxol-resistant cancer cell lines. At column 1 of this patent, it is disclosed that: "Many of the most common carcinomas, including breast and ovarian cancer, are initially relatively sensitive to a wide variety chemotherapy agents. However, acquired drug resistance phenotype typically occurs after months or years of exposure to chemotherapy. Determining the molecular basis of drug resistance may offer opportunities for improved diagnostic and therapeutic strategies."

[0181] As is also disclosed in U.S. Pat. No. 6,362,32, "Taxol is a natural product derived from the bark of Taxus brevafolio (Pacific yew). Taxol inhibits microtubule depolymerization during mitosis and results in subsequent cell death. Taxol displays a broad spectrum of tumorcidal activity including against breast, ovary and lung cancer (McGuire et al., 1996, N. Engld. J. Med. 334:1-6; and Johnson et al., 1996, J. Clin. Ocol. 14:2054-2060). While taxol is often effective in treatment of these malignancies, it is usually not curative because of eventual development of taxol resistance. Cellular resistance to taxol may include mechanisms such as enhanced expression of P-glycoprotein and alterations in tubulin structure through gene mutations in the .beta. chain or changes in the ratio of tubulin isomers within the polymerized microtubule (Wahl et al., 1996, Nature Medicine 2:72-79; Horwitz et al., 1993, Natl. Cancer Inst. 15:55-61; Haber et al., 1995, J. Biol. Chem. 270:31269-31275; and Giannakakou et al., 1997, J. Biol. Chem. 272:17118-17125). Some tumors acquires taxol resistance through unknown mechanisms."

[0182] International publication WO02/36603A2, the entire disclosure of which is hereby incorporated by reference into this specification, discloses nucleic acid molecules comprising a nucleotide sequence encoding a tubulin molecule. At pages 1 et seq. of this patent document, it is disclosed that: "Microtubules are essential to the eucaryotic cell due as they are involved in many processes and functions such as, e.g., being components of the cytoskeleton, of the centrioles and ciliums and in the formation of spindle fibres during mitosis. The constituents of microtubules are heterodimers consisting of one alpha-tubulin molecule and one beta-tubulin molecule. These two related self-associating 50 kDa proteins are encoded by a multigen family. The various members of this multigen family are dispersed all over the human genorne. Both alpha-tubulin and beta-tubulin are most likely to originate from a common ancestor as their amino acid sequence shows a homology of up to 50%. In man there are at least 15 genes or pseudogenes for tubulin.

[0183] As is also disclosed in International Publication WO0236603, "The conservation of structure and regulatory functions among the beta-tubulin genes in three vertebrate species (chicken, mouse and human) allowed the identification of and categorization into six major classes of beta-tubulin polypeptide isotypes on the basis of their variable carboxyterminal ends. The specific, highly variable 15 carboxyterminal amino acids are very conserved among the various species. Beta-tubulins of categories I, 11, and IV are closely related differing only 2-4% in contrast to categories III, V and VI which differ in 8-16% of amino acid positions [Sullivan K. F., 1988, Ann. Rev. Cell Biol. 4: 687-716].

[0184] As is also disclosed in International Publication WO0236603, "Also the expression pattern is very similar between the various species as can be taken from the following table [Sullivan K. F., 1988, Arm. Rev. Cell Biol. 4: 687-716] which comprises the respective human members of each class . . . . The C terminal end of the beta-tubulins starting from amino acid 430 is regarded as highly variable between the various classes. Additionally, the members of the same class seem to be very conserved between the various species."

[0185] As is also disclosed in International Publication WO0236603, "As tubulin molecules are involved in many processes and form part of many structures in the eucaryotic cell, they are possible targets for pharmaceutically active compounds. As tubulin is more particularly the main structural component of the microtubules it may act as point of attack for anticancer drugs such as vinblastin, colchicin, estramustin and taxol which interfere with microtubule function. The mode of action is such that cytostatic agents such as the ones mentioned above, bind to the carboxyterminal end the beta-tubulin which upon such binding undergoes a conformational change. For example, Kavallaris et al. [Kavallaris et al. 1997, J.Clin. Invest. 100: 1282-1293] reported a change in the expression of of specific beta- tubulin isotypes (class I, II, III, and IVa) in taxol resistant epithelial ovarian tumor. It was concluded that these tubulins are involved in the formation of the taxol resistence. Also a high expression of class III beta-tubulins was found in some forms of lung cancer suggesting that this isotype may be used as a diagnostic marker."

[0186] As is also disclosed in International Publication WO0236603, "The problem underlying the present invention was to provide the means to further characterize the various tubulins present in eucaryotic cells. A further problem underlying the present invention was to provide the means to extend possible screening programs for cytostatic agents to other isotypes of human beta-tubulins. This problem is solved in a first aspect by a nucleic acid molecule comprising a nucleotide sequence encoding a tubulin molecule, wherein said nucleic acid molecule comprises the sequence according to SEQ. ID. No. 1 This problem is solved in a second aspect by a nucleic acid molecule comprising a nucleotide sequence encoding a tubulin molecule, wherein said nucleic acid molecule comprises the sequence according to SEQ. ID. No. 2." The aforementioned SEQ. ID. No. 1 and SEQ. ID. No. 2 are referred to herein as SEQ. ID No. 291 and 292 respectively.

[0187] Published United States patent application 2002/0106705, the entire disclosure of which is hereby incorporated by reference into this specification, describes a method for detecting a modified beta-tubulin isotype. Claim 1 of this patent, which is typical, describes: "A method of detecting in a sample a .beta.-tubulin isotype modified at cysteine residue 239, the method comprising the steps of: (a) providing a sample treated with a .beta.-tubulin modifying agent; (b) contacting the sample with an antibody that specifically binds to a .beta.-tubulin isotype modified at cysteine residue 239; and (c) determining whether the sample contains a modified .beta.-tubulin isotype by detecting the antibody." This patent discloses that: "Microtubules are composed of .alpha./.beta.-tubulin heterodimers and constitute a crucial component of the cell cytoskeleton. Furthermore, microtubules play a pivotal role during cell division, in particular when the replicated chromosomes are separated during mitosis. Interference with the ability to form microtubules from .alpha./.beta.-tubulin heterodimeric subunits generally leads to cell cycle arrest. This event can, in certain cases, induce programmed cell death. Thus, natural products and organic compounds that interfere with microtubule formation have been used successfully as chemotherapeutic agents in the treatment of various human cancers."

[0188] Published United States patent application 2002/0106705 also discloses that: "Pentafluorophenylsulfonamidobenzenes and related sulfhydryl and disulfide modifying agents (see, e.g., compound 1; 2-fluoro-1-methoxy-4-pentafluorophenylsulfonamidobenzene . . . prevent microtubule formation by selectively covalently modifying .beta.-tubulin. For example, compound 1 does not covalently modify all of the five known .beta.-tubulin isotypes. Instead, binding is restricted to those .beta.-tubulin isotypes that have a cysteine residue at amino acid position 239 in .beta.-tubulin. Such isotypes include .beta.1, .beta.2 and .beta.4-tubulin. The other two isotypes (.beta.3 and .beta.5) have a serine residue at this particular position (Shan et al., Proc. Nat'l Acad. Sci USA 96:5686-5691 (1999)). It is notable that no other cellular proteins are modified by compound 1."

[0189] Published United States paent application 2002/0106705 relates primarily to a " . . . a .beta.-tubulin isotype modified at cysteine residue 239 . . . ." Thus, at page 3 of this published patent application, in defining a "beta-tubulin modifying agent," it describes such agent as follows: "A ".beta.-tubulin modifying agent" refers to an agent that has the ability to specifically react with an amino acid residue of .beta.-tubulin, preferably a cysteine, more preferably the cysteine residue at position 239 of a .beta.-tubulin isotype such as .beta.1- .beta.2- or .beta.4-tubulin and antigenic fragments thereof comprising the residue, preferably cysteine 239. The .beta.-tubulin modifying agent of the invention can be, e.g., any sulfhydryl or disulfide modifying agent known to those of skill in the art that has the ability to react with the sulfur group on a cysteine residue, preferably cysteine residue 239 of a .beta.-tubulin isotype. Preferably, the .beta.-tubulin modifying agents are substituted benzene compounds, pentafluorobenzenesulfonamides, arylsulfonanilide phosphates, and derivatives, analogs, and substituted compounds thereof (see, e.g., U.S. Pat. No. 5,880,151; PCT 97/02926; PCT 97/12720; PCT 98/16781; PCT 99/13759; and PCT 99/16032, herein incorporated by reference; see also Pierce Catalogue, 1999/2000, and Means, Chemical Modification of Proteins). In one embodiment, the agent is 2-fluoro-1-methoxy-4-pentafluorophenylsulfonamidobenzene (compound 1; FIG. 1C). Modification of a .beta.-tubulin isotype at an amino acid residue, e.g., cysteine 239, by an agent can be tested by treating a .beta.-tubulin peptide, described herein, with the putative agent, followed by, e.g., elemental analysis for a halogen, e.g., fluorine, reverse phase HPLC, NMR, or sequencing and HPLC mass spectrometry. Optionally compound 1 described herein can be used as a positive control. Similarly, an .alpha.-tubulin modifying agent refers to an agent having the ability to specifically modify an amino acid residue of an .alpha.-tubulin."

[0190] U.S. Pat. No. 6,541,509, the entire disclosure of which is hereby incorporated by reference into this specification, discloses a "method for treating neoplasis using combination chemotherapy." Claim 1 of this patent describes: "A method of treating neoplasia in a subject in need of treatment, comprising administering to the subject an amount of paclitaxel effective to treat the neoplasia, in combination with an amount of discodermolide effective to treat the neoplasia, wherein a synergistic antineoplastic effect results." At column 6 of this patent, the patentees discuss how to determine synergy between two drugs. They state that: One measure of synergy between two drugs is the combination index (CI) method of Chou and Talalay [37], which is based on the median-effect principle. This method calculates the degree of synergy, additivity, or antagonism between two drugs at various levels of cytotoxicity. Where the CI value is less than 1, there is synergy between the two drugs. Where the CI value is 1, there is an additive effect, but no synergistic effect. CI values greater than 1 indicate antagonism. The smaller the CI value, the greater the synergistic effect. Another measurement of synergy is the fractional inhibitory concentration (FIC) [48]. This fractional value is determined by expressing the IC50 of a drug acting in combination, as a function of the IC50 of the drug acting alone. For two interacting drugs, the sum of the FIC value for each drug represents the measure of synergistic interaction. Where the FIC is less than 1, there is synergy between the two drugs. An FIC value of 1 indicates an additive effect. The smaller the FIC value, the greater the synergistic interaction. In the method of the present invention, combination therapy using paclitaxel and discodermolide preferably results in an antineoplastic effect that is greater than additive, as determined by any of the measures of synergy known in the art." The cited Chou et al. reference is an entited "Quantitative analysis of dose effect relationships: the combined effect of multiple drugs or enzyme inhibitors," Adv. Enzyme Regul., 11:27-56 (1984). The cited "reference 48 is an article by Hall et al., "The fractional inhibitory concentration (FIC) as a measure of synergy," J. Antimicrob. Chemother., 11 (5):427-433 (1983).

[0191] Claim 8 of U.S. Pat. No. 6,541,509 describes "A synergistic combination of antineoplastic agents, comprising an effective antimenoplastic amount of paclitaxel and an effective antineoplastic amount of discodermolide." As one embodiment of the instant invention, applicants claims: A synergistic combination of antineoplastic agents, comprising an effective antimenoplastic amount of paclitaxel and an effective antineoplastic amount of the preferred, magnetic anti-mitotic compound of this inventon. Thus, the process of such U.S. Pat. No. 6,541,509 may be adapted to use the magnetic compound of this invention instead of discodermolide.

[0192] As is disclosed in U.S. Pat. No. 6,541,509, "The present invention provides a method of treating neoplasia in a subject in need of treatment. As used herein, `neoplasia` refers to the uncontrolled and progressive multiplication of cells under conditions that would not elicit, or would cause cessation of, multiplication of normal cells. Neoplasia results in the formation of a `neoplasm`, which is defined herein to mean any new and abnormal growth, particularly a new growth of tissue, in which the growth is uncontrolled and progressive. Malignant neoplasms are distinguished from benign in that the former show a greater degree of anaplasia, or loss of differentiation and orientation of cells, and have the properties of invasion and metastasis. Thus, neoplasia includes `cancer`, which herein refers to a proliferation of cells having the unique trait of loss of normal controls, resulting in unregulated growth, lack of differentiation, local tissue invasion, and metastasis." As support for this statement, the patent cited a work by Beers and Berkow (eds.), The Merck Manual of Diagnosis and Therapy, 17.sup.th edition (Whitehouse Station, N.J.; Merck Research Laboratories, 1999, 973-974, 976, 986, and 991).

[0193] As is also disclosed in U.S. Pat. No. 6,541,509, " . . . neoplasia is treated in a subject in need of treatment by administering to the subject an amount of paclitaxel effective to treat the neoplasia, in combination with an amount of discodermolide effective to treat the neoplasia, wherein a synergistic antineoplastic effect results. The subject is preferably a mammal (e.g., humans, domestic animals, and commercial animals, including cows, dogs, monkeys, mice, pigs, and rats), and is most preferably a human." In the embodiment described in this specification, the magnetic compound of this invention replaces discomdermolide.

[0194] As is also disclosed in U.S. Pat. No. 6,541,509, " . . . `paclitaxel` refers to paclitaxel and analogues and derivatives thereof, including, for example, a natural or synthetic functional variant of paclitaxel which has paclitaxel biological activity, as well as a fragment of paclitaxel having paclitaxel biological activity. As further used herein, the term "paclitaxel biological activity" refers to paclitaxel activity which interferes with cellular mitosis by affecting microtubule formation and/or action, thereby producing antimitotic and antineoplastic effects. Furthermore, as used herein, `antineoplastic` refers to the ability to inhibit or prevent the development or spread of a neoplasm, and to limit, suspend, terminate, or otherwise control the maturation and proliferation of cells in a neoplasm."

[0195] As is also disclosed in U.S. Pat. No. 6,541,509, "Methods of preparing paclitaxel and its analogues and derivatives are well-known in the art, and are described, for example, in U.S. Pat. Nos. 5,569,729; 5,565,478; 5,530,020; 5,527,924; 5,484,809; 5,475,120; 5,440,057; and 5,296,506. Paclitaxel and its analogues and derivatives are also available commercially. Synthetic paclitaxel, for example, can be obtained from Bristol-Myers Squibb Company, Oncology Division (Princeton, N.J.), under the registered trademark Taxol. Taxol for injection may be obtained in a single-dose vial, having a concentration of 30 mg/5 mL (6 mg/mL per 5 mL) [47]. Taxol and its analogues and derivatives have been used successfully to treat leukemias and tumors. In particular, Taxol is useful in the treatment of breast, lung, and ovarian cancers. Discodermolide and its analogues and derivatives can be isolated from extracts of the marine sponge, Discodermia dissoluta, as described, for example, in U.S. Pat. Nos. 5,010,099 and 4,939,168. Discodermolide and its analogues and derivatives also may be synthesized, as described, for example, in U.S. Pat. No. 6,096,904. Moreover, both paclitaxel and discodermolide may be synthesized in accordance with known organic chemistry procedures [46] that are readily understood by one skilled in the art."

[0196] As is also disclosed in U.S. Pat. No. 6,541,509, "In the method of the present invention, an amount of paclitaxel or discodermolide that is `effective to treat the neoplasia` is an amount that is effective to ameliorate or minimize the clinical impairment or symptoms of the neoplasia, in either a single or multiple dose. For example, the clinical impairment or symptoms of the neoplasia may be ameliorated or minimized by diminishing any pain or discomfort suffered by the subject; by extending the survival of the subject beyond that which would otherwise be expected in the absence of such treatment; by inhibiting or preventing the development or spread of the neoplasm; or by limiting, suspending, terminating, or otherwise controlling the maturation and proliferation of cells in the neoplasm. For example, doses of paclitaxel (Taxol) administered intraperitoneally may be between 1 and 10 mg/kg, and doses administered intravenously may be between 1 and 3 mg/kg, or between 135 mg/m2 and 200 mg/m2. However, the amounts of paclitaxel and discodermolide effective to treat neoplasia in a subject in need of treatment will vary depending on the particular factors of each case, including the type of neoplasm, the stage of neoplasia, the subject's weight, the severity of the subject's condition, and the method of administration. These amounts can be readily determined by the skilled artisan."

[0197] As is also disclosed in U.S. Pat. No. 6,541,509, "The method of the present invention may be used to treat neoplasia in a subject in need of treatment. Neoplasias for which the present invention will be particularly useful include, without limitation, carcinomas, particularly those of the bladder, breast, cervix, colon, head, kidney, lung, neck, ovary, prostate, and stomach; lymphocytic leukemias, particularly acute lymphoblastic leukemia and chronic lymphocytic leukemia; myeloid leukemias, particularly acute monocytic leukemia, acute promyelocytic leukemia, and chronic myelocytic leukemia; malignant lymphomas, particularly Burkitt's lymphoma and Non-Hodgkin's lymphoma; malignant melanomas; myeloproliferative diseases; sarcomas, particularly Ewing's sarcoma, hemangiosarcoma, Kaposi's sarcoma, liposarcoma, peripheral neuroepithelioma, and synovial sarcoma; and mixed types of neoplasias, particularly carcinosarcoma and Hodgkin's disease [45]. Preferably, the method of the present invention is used to treat breast cancer, colon cancer, leukemia, lung cancer, malignant melanoma, ovarian cancer, or prostate cancer." The aforementioned neoplasias may also be treated by the process of the instant invention.

[0198] As is also disclosed in U.S. Pat. No. 6,541,509, "In the method of the present invention, paclitaxel is administered to a subject in combination with discodermolide, such that a synergistic antineoplastic effect is produced. A `synergistic antineoplastic effect` refers to a greater-than-additive antineoplastic effect which is produced by a combination of two drugs, and which exceeds that which would otherwise result from individual administration of either drug alone. Administration of paclitaxel in combination with discodermolide unexpectedly results in a synergistic antineoplastic effect by providing greater efficacy than would result from use of either of the antineoplastic agents alone. Discodermolide enhances paclitaxel's effects. Therefore, lower doses of one or both of the antineoplastic agents may be used in treating neoplasias, resulting in increased therapeutic efficacy and decreased side-effects." As will be apparent, in applicants' invention the discodermolide is replaced by the magnetic anti-mitotic compound described in this specification.

[0199] As is also disclosed in U.S. Pat. No. 6,541,509, "Discodermolide also may provide a means to circumvent clinical resistance due to overproduction of P-glycoprotein. Accordingly, the combination of paclitaxel and discodermolide may be advantageous for use in subjects who exhibit resistance to paclitaxel (Taxol). Since Taxol is frequently utilized in the treatment of human cancers, a strategy to enhance its utility in the clinical setting, by combining its administration with that of discodermolide, may be of great benefit to many subjects suffering from malignant neoplasias, particularly advanced cancers." The comments made regading discodermolide are equally applicable to applicants' magnetic anti-mitotic agent.

[0200] As is also disclosed in U.S. Pat. No. 6,541,509, "In the method of the present invention, administration of paclitaxel `in combination with` discodermolide refers to co-administration of the two antineoplastic agents. Co-administration may occur concurrently, sequentially, or alternately. Concurrent co-administration refers to administration of both paclitaxel and discodermolide at essentially the same time. For concurrent co-administration, the courses of treatment with paclitaxel and with discodermolide may be run simultaneously. For example, a single, combined formulation, containing both an amount of paclitaxel and an amount of discodermolide in physical association with one another, may be administered to the subject. The single, combined formulation may consist of an oral formulation, containing amounts of both paclitaxel and discodermolide, which may be orally administered to the subject, or a liquid mixture, containing amounts of both paclitaxel and discodermolide, which may be injected into the subject." The same means of administration may be used in the process of the instant inventin.

[0201] As is also disclosed in U.S. Pat. No. 6,541,509, "It is also within the confines of the present invention that an amount of paclitaxel and an amount of discodermolide may be administered concurrently to a subject, in separate, individual formulations. Accordingly, the method of the present invention is not limited to concurrent co-administration of paclitaxel and discodermolide in physical association with one another." The same means of administration may be used in the process of the instant invention.

[0202] As is also disclosed in U.S. Pat. No. 6,541,509, "In the method of the present invention, paclitaxel and discodermolide also may be co-administered to a subject in separate, individual formulations that are spaced out over a period of time, so as to obtain the maximum efficacy of the combination. Administration of each drug may range in duration from a brief, rapid administration to a continuous perfusion. When spaced out over a period of time, co-administration of paclitaxel and discodermolide may be sequential or alternate. For sequential co-administration, one of the antineoplastic agents is separately administered, followed by the other. For example, a full course of treatment with paclitaxel may be completed, and then may be followed by a full course of treatment with discodermolide. Alternatively, for sequential co-administration, a full course of treatment with discodermolide may be completed, then followed by a full course of treatment with paclitaxel. For alternate co-administration, partial courses of treatment with paclitaxel may be alternated with partial courses of treatment with discodermolide, until a full treatment of each drug has been administered." The same means of administration may be used in the process of the instant invention.

[0203] As is also disclosed in U.S. Pat. No. 6,541,509, "The antineoplastic agents of the present invention (i.e., paclitaxel and discodermolide, either in separate, individual formulations, or in a single, combined formulation) may be administered to a human or animal subject by known procedures, including, but not limited to, oral administration, parenteral administration (e.g., intramuscular, intraperitoneal, intravascular, intravenous, or subcutaneous administration), and transdermal administration. Preferably, the antineoplastic agents of the present invention are administered orally or intravenously." The same means of administration may be used in the process of the instant invention.

[0204] As is also disclosed in U.S. Pat. No. 6,541,509, "For oral administration, the formulations of paclitaxel and discodermolide (whether individual or combined) may be presented as capsules, tablets, powders, granules, or as a suspension. The formulations may have conventional additives, such as lactose, mannitol, corn starch, or potato starch. The formulations also may be presented with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatins. Additionally, the formulations may be presented with disintegrators, such as corn starch, potato starch, or sodium carboxymethyl-cellulose. The formulations also may be presented with dibasic calcium phosphate anhydrous or sodium starch glycolate. Finally, the formulations may be presented with lubricants, such as talc or magnesium stearate." The same means of administration may be used in the process of the instant invention.

[0205] As is also disclosed in U.S. Pat. No. 6,541,509, "For parenteral administration, the formulations of paclitaxel and discodermolide (whether individual or combined) may be combined with a sterile aqueous solution which is preferably isotonic with the blood of the subject. Such formulations may be prepared by dissolving a solid active ingredient in water containing physiologically-compatible substances, such as sodium chloride, glycine, and the like, and having a buffered pH compatible with physiological conditions, so as to produce an aqueous solution, then rendering said solution sterile. The formulations may be presented in unit or multi-dose containers, such as sealed ampules or vials. Moreover, the formulations may be delivered by any mode of injection, including, without limitation, epifascial, intracapsular, intracutaneous, intramuscular, intraorbital, intraperitoneal (particularly in the case of localized regional therapies), intraspinal, intrasternal, intravascular, intravenous, parenchymatous, or subcutaneous." The same means of administration may be used in the process of the instant invention.

[0206] As is also disclosed in U.S. Pat. No. 6,541,509, "For transdermal administration, the formulations of paclitaxel and discodermolide (whether individual or combined) may be combined with skin penetration enhancers, such as propylene glycol, polyethylene glycol, isopropanol, ethanol, oleic acid, N-methylpyrrolidone, and the like, which increase the permeability of the skin to the antineoplastic agent, and permit the antineoplastic agent to penetrate through the skin and into the bloodstream. The antineoplastic agent/enhancer compositions also may be further combined with a polymeric substance, such as ethylcellulose, hydroxypropyl cellulose, ethylene/vinylacetate, polyvinyl pyrrolidone, and the like, to provide the composition in gel form, which may be dissolved in a solvent such as methylene chloride, evaporated to the desired viscosity, and then applied to backing material to provide a patch." The same means of administration may be used in the process of the instant invention.

[0207] As is also disclosed in U.S. Pat. No. 6,541,509, "It is within the confines of the present invention that the formulations of paclitaxel and discodermolide (whether individual or combined) may be further associated with a pharmaceutically-acceptable carrier, thereby comprising a pharmaceutical composition. The pharmaceutically-acceptable carrier must be "acceptable" in the sense of being compatible with the other ingredients of the composition, and not deleterious to the recipient thereof. Examples of acceptable pharmaceutical carriers include Cremophor.TM. (a common vehicle for Taxol), as well as carboxymethyl cellulose, crystalline cellulose, glycerin, gum arabic, lactose, magnesium stearate, methyl cellulose, powders, saline, sodium alginate, sucrose, starch, talc, and water, among others. Formulations of the pharmaceutical composition may conveniently be presented in unit dosage." The same means of administration may be used in the process of the instant invention.

[0208] As is also disclosed in U.S. Pat. No. 6,541,509, "The formulations of the present invention may be prepared by methods well-known in the pharmaceutical art. For example, the active compound may be brought into association with a carrier or diluent, as a suspension or solution. Optionally, one or more accessory ingredients (e.g., buffers, flavoring agents, surface active agents, and the like) also may be added. The choice of carrier will depend upon the route of administration. The pharmaceutical composition would be useful for administering the antineoplastic agents of the present invention (i.e., paclitaxel and discodermolide, and their analogues and derivatives, either in separate, individual formulations, or in a single, combined formulation) to a subject to treat neoplasia. The antineoplastic agents are provided in amounts that are effective to treat neoplasia in the subject. These amounts may be readily determined by the skilled artisan." Similar formulations may be used in the process of the instant invention.

[0209] As is also disclosed in U.S. Pat. No. 6,541,509, "It is also within the confines of the present invention that paclitaxel and discodermolide be co-administered in combination with radiation therapy or an antiangiogenic compound (either natural or synthetic). Examples of antiangiogenic compounds with which paclitaxel and discodermolide may be combined include, without limitation, angiostatin, tamoxifen, thalidomide, and thrombospondin." Similar compositons may be used in the process of the instant invention.

[0210] As is also disclosed in U.S. Pat. No. 6,541,509, "The present invention further provides a synergistic combination of antineoplastic agents. As defined above, `antineoplastic` refers to the ability to inhibit or prevent the development or spread of a neoplasm, and to limit, suspend, terminate, or otherwise control the maturation and proliferation of cells in a neoplasm. As used herein, a "synergistic combination of antineoplastic agents" refers to a combination of antineoplastic agents that achieves a greater antineoplastic effect than would otherwise result if the antineoplastic agents were administered individually. Additionally, as described above, the "antineoplastic agents" of the present invention are paclitaxel and discodermolide, and their analogues and derivatives, either in separate, individual formulations, or in a single, combined formulation. Administration of paclitaxel in combination with discodermolide unexpectedly results in a synergistic antineoplastic effect by providing greater efficacy than would result from use of either of the antineoplastic agents alone." Similar synergistic combinations may be used in the process of the instant invention.

[0211] As is also disclosed in U.S. Pat. No. 6,541,509, "In the synergistic combination of the present invention, paclitaxel and discodermolide may be combined in a single formulation, such that the amount of paclitaxel is in physical association with the amount of discodermolide. This single, combined formulation may consist of an oral formulation, containing amounts of both paclitaxel and discodermolide, which may be orally administered to the subject, or a liquid mixture, containing amounts of both paclitaxel and discodermolide, which may be injected into the subject." Similar synergistic combinations may be used in the process of the instant invention.

[0212] As is also disclosed in U.S. Pat. No. 6,541,509, "Alternatively, in the synergistic combination of the present invention, a separate, individual formulation of paclitaxel may be combined with a separate, individual formulation of discodermolide. For example, an amount of paclitaxel may be packaged in a vial or unit dose, and an amount of discodermolide may be packaged in a separate vial or unit dose. A synergistic combination of paclitaxel and discodermolide then may be produced by mixing the contents of the separate vials or unit doses in vitro. Additionally, a synergistic combination of paclitaxel and discodermolide may be produced in vivo by co-administering to a subject the contents of the separate vials or unit doses, according to the methods described above. Accordingly, the synergistic combination of the present invention is not limited to a combination in which amounts of paclitaxel and discodermolide are in physical association with one another in a single formulation." Similar synergistic combinations may be used in the process of the instant invention.

[0213] As is also disclosed in U.S. Pat. No. 6,541,509, "The synergistic combination of the present invention comprises an effective antineoplastic amount of paclitaxel and an effective antineoplastic amount of discodermolide. As used herein, an `effective antineoplastic amount` of paclitaxel or discodermolide is an amount of paclitaxel or discodermolide that is effective to ameliorate or minimize the clinical impairment or symptoms of neoplasia in a subject, in either a single or multiple dose. For example, the clinical impairment or symptoms of neoplasia may be ameliorated or minimized by diminishing any pain or discomfort suffered by the subject; by extending the survival of the subject beyond that which would otherwise be expected in the absence of such treatment; by inhibiting or preventing the development or spread of the neoplasm; or by limiting, suspending, terminating, or otherwise controlling the maturation and proliferation of cells in the neoplasm." These comments are equally applicable to the process of the instant invention, in which discodermolide is replaced by the magnetic anti-mitotic compound of this invention.

[0214] As is also discussed in U.S. Pat. No. 6,541,509, "The effective antineoplastic amounts of paclitaxel and discodermolide will vary depending on the particular factors of each case, including the type of neoplasm, the stage of neoplasia, the subject's weight, the severity of the subject's condition, and the method of administration. For example, effective antineoplastic amounts of paclitaxel (Taxol) administered intraperitoneally may range from 1 to 10 mg/kg, and doses administered intravenously may range from 1 to 3 mg/kg, or from 135 mg/m2 to 200 mg/m2. Nevertheless, the appropriate effective antineoplastic amounts of paclitaxel and discodermolide can be readily determined by the skilled artisan." These comments are equally applicable to the process of the instant invention, in which discodermolide is replaced by the magnetic anti-mitotic compound of this invention

[0215] As is also disclosed in U.S. Pat. No. 6,541,509, "The synergistic combination described herein may be useful for treating neoplasia in a subject in need of treatment. Paclitaxel and discodermolide, which comprise the synergistic combination of the present invention, may be co-administered to a subject concurrently, sequentially, or alternately, as described above. Moreover, the paclitaxel and discodermolide of the present invention may be administered to a subject by any of the methods, and in any of the formulations, described above." These comments are equally applicable to the process of the instant invention, in which discodermolide is replaced by the magnetic anti-mitotic compound of this invention

[0216] By way of yet further illustration, and referring to published United States patent application 2003/0235855 (the entire disclosure of which is hereby incorporated by reference into this specification), claims an assay for the detection of paclitaxel resistant cells in human tumors. Claim 4 of this published patent application, which is typical, claims: "An isolated tubulin amino acid sequence comprising an amino acid sequence having at least one mutation, the mutation selected from the group consisting of a mutation at position 210, a mutation at position 214, a mutation at position 215, a mutation at position 216, a mutation at position 217, a mutation at position 225, a mutation at position 228, a mutation at position 270, a mutation at position 273, a mutation at position 292, and a mutation at position 365 and any combination thereof."

[0217] At page 1 of published United States patent application 2003/0235855, the importance of paclitaxel is discussed. It is disclosed that "Paclitaxel (Taxol), Taxotere and other paclitaxel-like drugs that are currently under development hold great promise for the treatment of human cancer. Paclitaxel has shown remarkable activity against breast and ovarian cancer, melanomas, non-small lung carcinoma, esophogeal cancer, Kaposi's sarcoma, and some hematological malignancies. It has been described as the most significant antitumor drug developed in the last several decades and will, without doubt, find widespread use in the treatment of cancer. However, as is true of virtually all cancer chemotherapeutic drugs, patients responsive to paclitaxel eventually relapse due to the emergence of drug resistant tumor cells. Thus, there is a need in the art for methods to identify paclitaxel-resistant tumor cells, for agents that allow such identifications in a simple and cost effective way, and for methods for to treat patients with paclitaxel resistant tumor cells." The solution presented to this problem in such published patent application is also described at page 1 thereof, wherein it is stated that: "The present invention involves polynucleotide mutations which confer paclitaxel resistance; mutant cells which are paclitaxel resistant; and methods to determine paclitaxel resistance. The present invention also provides a simple assay with sufficient sensitivity to detect drug resistant cells in tumor biopsies by extracting polynucleotide from the tissue. The extracted polynucleotide is then hybridized to mutant-specific PCR primers and the mutant regions of tubulin are identified by selective amplification. Once identified, a secondary treatment protocol can be administered to the patient to aid in tumor treatment."

[0218] At pages 2 et seq. of published United States patent application 2003/0235855, the inventor discloses that " . . . mutations able to conver resistance to paclitaxel are clustered in several small regions of beta-tubulin." In paragraphs 0022 et seq., it is disclosed that: "The inventor has found that mutations able to confer resistance to paclitaxel are clustered in several small regions of .beta.-tubulin (Tables I-III) including I210T, T214A, L215H, L215R, L215F, L215A, L215E, L215M, L215P, K216A, L217R, L217N, L217A, L225M, L228A, L228F, L228H, F270C, L273V, Q292H, and V365D. Of these 21 identified and sequenced mutant tubulins, 15 or 62% have a substitution at leucine including locations 215, 217, 225, 228 and 273. Of the 15 total leucine mutants, 7 or 46.7% occur at leu215, 3 or 20% occur at leu217, 3 or 20% occur at leu228, 1 or 6.7% occur at leu225 and 1 or 6.7% occur at leu273. The ability of 19 of the 21 total mutations to confer paclitaxel resistance has been confirmed by transfecting mutant cDNAs into wild-type cells."

[0219] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 3 thereof) that:"The clustering of mutations affecting leucines is unusual and unexpected. Also unexpected is the three relatively localized regions of mutation, 210-217, 225-228, and 270-273, and two isolated sites of mutations, 292 and 365. Although some of these regions appear distant in the primary structure, they are actually close together in the tertiary structure of .beta.-tubulin. The data support the hypothesis that the mutations affect a critical interaction between tubulin subunits necessary for microtubule assembly and that the mechanism of paclitaxel is to facilitate this interaction." Thereafter, in the middle of page 3 of such patent application, Table 1 is presented.

[0220] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 3 thereof) that: "Table V below contains the corresponding .beta.-tubulin protein sequences for the variants listed in Table I: L215H (Seq. No. 10); L215R (Seq. No. 11); L215F (Seq. No. 12); L217R (Seq. No. 13); L228F (Seq. No. 14); and L228H (Seq. No. 15).AII of these mutations result in amino acid substitutions at 3 leucine residues that are within 14 amino acids of one another." The aforementioned Seq. No. 10, 11, 12, 13, 14, and 15 are listed in this application's sequence listing as SEQ. ID. No. 293, 294, 295, 296, 297 and 298 respectively.

[0221] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 3 thereof) that: "Using site-directed mutagenesis, the inventor has identified additional mutations in the H6/H7 loop of beta tubulin (that contains L215 and L217) that confer paclitaxel resistance. Table II lists the cell line, a portion of the encoding region including the mutated codon and the protein alteration." Thereafer, Table II is presented on page 3 of the patent application.

[0222] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 4 thereof) that: "The corresponding .beta.-tubulin protein sequences (see Table IV) are: T214A (Seq. No. 24), L215A (Seq. No. 25), L215E (Seq. No. 26), L215M (Seq. No. 27), L215P (Seq. No. 28), K216A (Seq. No. 29), L217A (Seq. No. 30) and L228A (Seq. No. 31). The present invention also relates to probes having at least 12 bases including the codon for the particular amino acid substitution." The aforementioned Seq. No. 24, 25, 26, 27, 28, 29, 30 and 31 are listed in this application's sequence listing as SEQ. ID. No. 299, 300, 301, 302, 303, 304, 305, and 306 respectively.

[0223] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 3 thereof) that: "More recently, the inventor has found that the number of mutations that confer resistance to paclitaxel are likely to be small and that most are clustered in a small region of .beta.-tubulin. The likelihood that only a relatively small number of mutations will cause paclitaxel resistance is indicated by the observation that a random mutagenesis approach to find new mutations is recapitulating mutations that have already been found by classical genetics, and by the observation that mutations reported in different laboratories using different cell lines are beginning to show overlap. New mutants recently identified by the inventor in both CHO cells, and in the human KB3 cervical carcinoma cell line, are summarized in Table m. The fact that human mutations fall into the same region as the CHO mutations in the tertiary structure, combined with the observation that some mutations (not reported in this application) in CHO cells affect residues that are altered in human cell lines, supports the conclusion (based on identical amino acid sequences for .beta.-tubulin in the two species) that mutations identified in CHO cells are expected to confer drug resistance in human cells. The nucleotide sequences encoding the new mutants are shown in Table III. 3 TABLE III" Thereafter, Table III is repesented on page 4.

[0224] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 4 thereof) that: "The new corresponding mutant CHO .beta.-tubulin protein sequences (see Table IV) are: I210T (Ile to Thr at location 210) (Seq. No. 39), L217N (Leu to Asn at location 217) (Seq. No. 40), F270C (Phe to Cys at location 270) (Seq. No. 41) and Q292H (Gln to His at location 292) (Seq. No. 42). The new corresponding mutant human .beta.-tubulin sequences are: L225M (Leu to Met at location 225) (Seq. No.43), L273V (Leu to Val at location 273) (Seq. No. 44) and V365D (Val to Asp at location 365) (Seq. No. 45)." The aforementioned Seq. No. 39, 40, 41, 42, 43, 44, and 45 are listed in this application's sequence listing as SEQ. ID. No. 307, 308, 309, 310, 311, 312, and 313 respectively.

[0225] It is also disclosed in published United States patent application 2003/0235855 (commencing at page 4 thereof) that: "Table IV lists all of the nucleic acid and protein sequences in sequence order that are described in this application along with their sequence id number and abbreviated amino acid mutation." Thereafter, Table IV is presented on pages 4 et seq.

[0226] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "Because .alpha.-tubulin and .beta.-tubulin are similar proteins, similar clustering of mutations are anticipated in .alpha.-tubulin in paclitaxel resistant cells and .alpha.-tubulin PCR mutant primer sequences can be constructed in a similar manner to the primers presented herein for .beta.-tubulin in paclitaxel resistant tumor cells."

[0227] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "The assays of the present invention were performed using Chinese hamster ovary (CHO) cells selected for resistance to paclitaxel. It is important to note that human and hamster tubulin have identical amino acid sequences and the nucleotide sequences are highly homologous and the nucleotide differences do not alter the amino acid sequence, and therefore, the amino acid changes found in mutant CHO cells will also confer resistance in humans."

[0228] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "It has been established that the most frequent mechanism of resistance to paclitaxel occurs through mutations in tubulin that affect the stability of the microtubules. These paclitaxel-resistant cells assemble less microtubule polymer and are frequently hypersensitive to other drugs such as vinblastine and vincristine that inhibit microtubule assembly."

[0229] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "A model to explain these observations is provided in FIG. 1. The assay of the present invention can be used to identify many or most patients in danger of relapse due to tumor cell mutation and allow administration of alternate or additional treatment protocols using such agents as vinblastine or vincristine which are highly effective in eliminating the paclitaxel-resistant cells."

[0230] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "The identification of the mutations and the clustering of mutations within the tubulin genes provide the data to construct highly efficient assays to detect these mutations in patients. Until now, there has been no method available to easily detect paclitaxel resistant cells in human tumors. The present methods or assays involve the design and use of allele-specific oligonucleotide primers for PCR."

[0231] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "One such assay has been successfully confirmed for primers using the leu217 to arg mutation shown in FIG. 2. The wild-type primer (CTCCGTAGGTGGGCGTGGTGA (Seq. No.46)) is able to amplify wild-type DNA; but because of a 3' mismatch with the mutant allele, it fails to amplify mutant DNA. Conversely, the mutant primer (CTCCGTAGGTGGGCGTGCGC (Seq. No. 47)) is able to amplify mutant DNA, but does not amplify the wild-type DNA because of 3' mismatch (underlined). The mutant primer also contains an intentional mismatch to both wild-type and mutant DNA at the third nucleotide from the 3' end (underlined) in order to enhance its allele specificity." The aforementioned Seq. No. 46 and 47 are listed in this application's sequence listing as SEQ. ID. No. 314 and 315 respectively.

[0232] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 8 thereof) that: "Thus, allele-specific primers covering most potential mutations can be used individually or a `cocktails` to detect the mutations in a single or very few PCR reactions. Alternatively, assays involving restriction enzyme digestion or allele-specific hybridization using the mutant DNA sequences can be used, but may lack the sensitivity and simplicity of the PCR assay."

[0233] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 9 thereof) that: "The high frequency of mutations affecting only a few leucine residues of .alpha.-tubulin in paclitaxel-resistant mutants was unexpected. Currently, there is no rational basis for predicting how an individual patient will respond to paclitaxel therapy. An initial assay of the tumor for mutations in tubulin that confer paclitaxel resistance would help clinicians decide whether the patient is a good candidate for paclitaxel therapy and save needless morbidity with a treatment that is unlikely to be effective. It would also allow the clinician to choose an alternative or additional therapy at an early time in the disease progression, thereby enhancing the survival of the patient."

[0234] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 9 thereof) that: "Mammals express 6 .alpha.- and 6 .beta.-tubulin genes, which are the targeted genes. To further optimize assays, it may be necessary to determine which tubulin isotype is involved in paclitaxel resistance for each type of tumor in certain instances. The tubulin is expressed in a tissue specific manner, with some forms restricted to certain tissues, which are widely disclosed in the prior art literature. Furthermore, the present inventors have found in CHO cells that the most abundant tubulin isotype is the one always involved in conferring resistance, which was completely unexpected. Thus, one skilled in the art must merely find the most abundant isotype for each type of tumor, which is disclosed in many technical journal and prior art references."

[0235] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 9 thereof) that: "Paclitaxel is the prototype for a novel class of agents that inhibit cells in mitosis by promoting and stabilizing microtubule assembly. Early studies with this compound demonstrated that it binds to microtubules in a 1:1 stoichiometry with tubulin heterodimers (Manfredi, J. J., Parness, J., and Horwitz, S. B. (1981) J. Cell Biol. 94, 688-696) and inhibits microtubule disassembly. It is also able to induce microtubule assembly both in vitro and in vivo and induces microtubule bundle formation in treated cells (Schiff, P. B., Fant, J., and Horwitz, S. B. (1979) Nature 277, 665-667 and Schiff, P. B., and Horwitz, S. B. (1980) Proc. Natl. Acad. Sci. U.S.A. 77, 1561-1565). Recent interest in this and related compounds has been fueled by clinical studies demonstrating remarkable activity of paclitaxel against a number of malignant diseases (Rowinsky, E. K., and Donehower, R. C. (1995) N. E. J. Med. 332, 1004-1014). Although still in clinical trials, the demonstrated activity of paclitaxel in phase 11 studies has led to FDA approval for its use in refractory cases of breast and ovarian cancer. As more patients are treated with this drug, clinical resistance is expected to become an increasingly significant problem."

[0236] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 9 thereof) that: "The mechanisms by which tumor cells acquire resistance to paclitaxel are not fully understood. Cell culture studies have shown that paclitaxel is a substrate for the multidrug resistance pump (gP170), and cells selected for high levels of resistance to the drug have increased gP170 (Casazza, A. M., and Fairchild, C. R. (1996) Cancer Treatment & Research 87, 149-71). Nevertheless, it has yet to be demonstrated that this mechanism is significant in paclitaxel refractory tumors. Indeed, the remarkable efficacy of paclitaxel in early clinical studies of patients who were pretreated with Adriamycin, a well known substrate for gP170, argues that the multidrug resistance (mdr) phenotype may not be as clinically prevalent as had initially been anticipated (Schiff, P. B., and Horwitz, S. B. (1980) Proc. Natl. Acad. Sci. U.S.A. 77, 1561-1565)."

[0237] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 9 thereof) that: "Additional mechanisms of resistance to paclitaxel have been reported. For example, several laboratories have provided evidence that changes in the expression of specific .beta.-tubulin genes are associated with paclitaxel resistance in cultured tumor cell lines (Haber, M., Burkhart, C. A., Regl, D. L., Madafiglio, J., Norris, M. D., and Horwitz, S. B. (1995) J. Biol. Chem. 270, 31269-75; Jaffrezou, J. P., Dumontet, C., Derry, W. B., Duran, G., Chen, G., Tsuchiya, E., Wilson, L., Jordan, M. A., and Sikic, B. I. (1995) Oncology Res. 7, 517-27; Kavallaris, M., Kuo, D. Y. S., Burkhart, C. A., Regl, D. L., Norris, M. D., Haber, M., and Horwitz, S. B. (1997) J. Clin. Invest. 100, 1282-93; and Ranganathan, S., Dexter, D. W., Benetatos, C. A., and Hudes, G. R. (1998) Biochim. Biophys. Acta 1395, 237-245). More recently, a report describing mutations in .beta.-tubulin that make the protein unresponsive to paclitaxel has appeared (Giannakakou, P., Sackett, D. L., Kang, Y.-K., Zhan, Z., Buters, J. T. M., Fojo, T., and Poruchynsky, M. S. (1997) J. Biol. Chem. 272, 17118-17125). To date, however, there is little evidence that any of the mechanisms described in cell culture cause paclitaxel resistance in human tumors."

[0238] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 9 thereof) that "The inventor's own studies have described a resistance mechanism mediated by tubulin alterations that affect microtubule assembly (Cabral, F., and Barlow, S. B. (1991) Pharmac. Ther. 52, 159-171). Based on mutant properties and drug cross-resistance patterns, it is proposed that these changes in microtubule assembly could compensate for the presence of the drug (Cabral, F., Brady, R. C., and Schibler, M. J. (1986) Ann. N.Y. Acad. Sci. 466, 745-756). The inventors were later able to directly demonstrate that paclitaxel resistant Chinese hamster ovary (CHO) cells have diminished microtubule assembly compared to wild-type controls (Minotti, A. M., Barlow, S. B., and Cabral, F. (1991) J. Biol. Chem. 266, 3987-3994). Thus, isolation of paclitaxel resistant mutants provides an opportunity to study mutations that not only give information about the mechanisms of drug action and resistance, but also give structural information about regions of tubulin that are involved in assembly."

[0239] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 10thereof) that: "The inventors have now sequenced 9 mutant .beta.-tubulin alleles and find that the mutations cluster at a site that is likely to be involved in lateral or longitudinal interactions during microtubule assembly. Remarkably, these mutations are present in the H6H7 region of of tubulin. Previously, it was believed that this region was not associated with paclitaxel binding. However, the inventors have isolated mutants in the H6H7 region, which are directly related to paclitaxel resistence."

[0240] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 10 thereof) that: "There is some significance to the fact that all the mutated residues are leucines--it certainly indicates that the changes that produce taxol resistance are not random. One possibility is that the leucines define a structural motif (e.g., analogous to a leucine zipper, but clearly distinct) that forms an interaction site with a neighboring subunit. A more trivial explanation is that the leucines are among the least critical residues in the region and are therefore better able to tolerate changes that produce the kind of subtle alterations in tubulin assembly that give resistance to taxol. The fact that the 3 leucines are highly conserved throughout all species and that the conservation extends to alpha and even gamma tubulin would tend to argue for the former alternative, but it will take a lot of further experimentation before the true significance can be elucidated."

[0241] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 10 thereof) that: "All 3 leucines in hamster are encoded by a CTC. Thus, a single base change can lead to substitution of histidine, arginine, phenylalanine, isoleucine, valine, or pro line. Only his, arg, and phe were isolated in the mutant cell lines. By transfection of cDNA altered by site-directed mutagenesis, is has been found that ile and val do not produce taxol resistance, probably because they do not perturb the structure of the microtubule sufficiently to produce resistance. Proline substitution can cause resistance, but appears to do so when expressed at very low levels. Moreover, the inventors have not been able to express it at high levels. This suggests that pro was not isolated in the mutant cell lines because it disrupts the structure of microtubules too severely for the cells to survive."

[0242] It is also disclosed in United States published patent application 2003/0235855 (commencing at page 10 thereof) that: "The codons for leucine in human DNA are CTG at positions 215 and 217, and CTT at position 228. Single nucleotide changes will produce the same amino acid substitutions at 228, but a different set (valine, methionine, glutamine, arginine, or proline) at 215 and 217. Thus, 2 new possibilities (methionine and glutamine) might be found at 215 or 217 in human cells resistant to taxol. Of the two, methionine has been tested by transfection and it turns out to produce borderline resistance even at high levels of expression. A glutamine substitution has not yet been tested and should therefore be considered a presumptive candidate for producing resistance."

A Preferred Anti-Mitotic Compound

[0243] In this section of the specification, a preferred compound is discussed. The preferred compound of this embodiment of the invention is an anti-mitotic compound. Anti-mitotic compounds are known to those skilled in the art. Reference may be had, e.g., to U.S. Pat. No. 6,723,858 (estrogenic compounds as anti-mitotic agents), U.S. Pat. No. 6,528,676 (estrogenic compounds as anti-mitotic agents), U.S. Pat. No. 6,350,777 (anti-mitotic agents which inhibit tubulin polyumerization), U.S. Pat. No. 6,162,930 (anti-mitotic agents which inhibit tubulin polymerization), U.S. Pat. No. 5,892,069 (estrogenic compounds as anti-mitotic agents), U.S. Pat. No. 5,886,025 (anti-mitotic agents which inhibit tubulin polymerization), U.S. Pat. No. 5,661,143 (estrogenic compounds as anti-mitotic agents), U.S. Pat. No. 3,997,506 (anti-mitotic derivatives of thiocolchicine), and the like. The entire disclosure of each of these United States patents applications is hereby incorporated by reference into this specification.

[0244] These prior art anti-mitotic agents may be modified, in accordance with the process of this invention, to make them "magnetic," as that term is defined in this specification. In the next section of this specification, a process for modifying prior art taxanes to-make them "magnetic" is described.

Preparation and Use of Magnetic Taxanes

[0245] In this portion of the specification, applicants will describe the preparation of certain magnetic taxanes that may be used in one or more of the processes of his invention. The process that is ued to make such taxanes magnetic and/or water soluble may also be used to make other anti-mitotic compounds magnetic and/or water soluble.

[0246] In one embodiment of the invention, a biologically active substrate is linked to a magnetic carrier particle. An external magnetic field may then be used to increase the concentration of a magnetically linked drug at a predetermined location.

[0247] One method for the introduction of a magnetic carrier particle involves the linking of a drug with a magnetic carrier. While some naturally occurring drugs inherently carry magnetic particles (ferrimycin, albomycin, salmycin, etc.), it is more common to generate a synthetic analog of the target drug and attach the magnetic carrier through a linker.

Functionalized Taxanes

[0248] Paclitaxel and docetaxel are members of the taxane family of compounds. A variety of taxanes have been isolated from the bark and needles of various yew trees

[0249] In one embodiment of the invention, such a linker is covalently attached to at least one of the positions in taxane.

[0250] It is well known in the art that the northern hemisphere of taxanes has been altered without significant impact on the biological activity of the drug. Reference may be had to Chapter 15 of Taxane Anticancer Agents, Basic Science and Current Status, edited by G. George et al., ACS Symposium Series 583, 207.sup.th National Meeting of the American Chemical Society, San Diego, Calif. (1994). Specifically the C-7, C-9, and C-10 positions of paclitaxel have been significantly altered without degrading the biological activity of the parent compound. Likewise the C-4 position appears to play only a minor role. The oxetane ring at C-4 to C-5 has been shown to be critical to biological activity. Likewise, certain functional groups on the C-13 sidechain have been shown to be of particular importance.

[0251] In one embodiment of the invention, a position within paclitaxel is functionalized to link a magnetic carrier particle. A number of suitable positions are presented below. It should be understood that paclitaxel is illustrated in the figures below, but other taxane analogs may also be employed. Attachment at C-4

[0252] C-4 taxane analogs have been previously generated in the art. A wide range of methodologies exist for the introduction of a variety of substituents at the C-4 position. By way of illustration, reference may be had to "Synthesis and Biological Evaluation of Novel C-4 Aziridine-Bearing Paclitaxel Analogs" by S. Chen et al., J. Med. Chem. 1995, vol 38, pp 2263.

[0253] The secondary (C-13) and tertiary (C-1) alcohols of 7-TES baccatin were protected using the procedure of Chen (J. Org. Chem. 1994, vol 59, p 6156) while simultaneously unmasking the alcohol at C-4. The resulting product was treated with a chloroformate to yield the corresponding carboxylate. Removal of the silyl protecting groups at C-1, C-7, and C-13, followed by selective re-protection of the C-7 position gave the desired activated carboxylate. The compound was then treated with a suitable nucleophile (in the author's case, ethanolamine) to produce a C-4 functionalized taxane. The C-13 sidechain was installed using standard lactam methodology.

[0254] This synthetic scheme thus provides access to a variety of C-4 taxane analogs by simply altering the nucleophile used. In one embodiment of the instant invention, the nucleophile is selected so as to allow the attachment of a magnetic carrier to the C-4 position.

Attachment at C-7

[0255] The C-7 position is readily accessed by the procedures taught in U.S. Pat. No. 6,610,860. The alcohol at the C-10 position of 10-deacetylbaccatin III was selectively protected. The resulting product was then allowed to react with an acid halide to produce the corresponding ester by selectively acylating the C-7 position over the C-13 alcohol. Standard lactam methodology allowed the installation of the C-13 sidechain. In another embodiment, baccatin III, as opposed to its deacylated analog, is used as the starting material.

[0256] Other C-7 taxane analogs are disclosed in, U.S. Pat. Nos. 6,610,860; 6,359,154; and 6,673,833, the contents of which are hereby incorporated by reference.

Attachment at C-9

[0257] It has been established that the C-9 carbonyl of paclitaxel is relatively chemically inaccessible, although there are exceptions (see, for example, Tetrahedron Lett. Vol 35, p 4999). However, scientists gained access to C-9 analogs when 13-acetyl-9-dihydrobaccatin III was isolated from Taxus candidensis (see J. Nat. Products, 1992, vol 55, p 55 and Tetrahedron Lett. 1992, vol 33, p 5173). This triol is currently used to provide access to a variety of such C-9 analogues.

[0258] In chapter 20 of Taxane Anticancer Agents, Basic Science and Current Status, (edited by G. George et al., ACS Symposium Series 583, 207.sup.th National Meeting of the American Chemical Society, San Diego, Calif. (1994)) Klein describes a number of C-7/C-9 taxane analogs. One of routes discussed by Klein begins with the selective deacylation of 13-acetyl-9-dihydrobaccatin III, followed by the selective protection of the C7 alcohol as the silyl ether. A standard lactam coupling introduced the C-13 sidechain. The alcohols at C-7 and C-9 were sufficiently differentiated to allow a wide range of analogs to be generated. "In contrast to the sensitivity of the C-9 carbonyl series under basic conditions, the 9(R)-dihydro system can be treated directly with strong base in order to alkylate the C-7 and/or the C-9 hydroxyl groups."

[0259] One skilled in the art may adapt Klein's general procedures to install a variety of magnetic carriers at these positions. Such minor adaptations are routine for those skilled in the art.

Attachment at C-7 and C-9

[0260] Klein also describes a procedure wherein 13-acetyl-9-dihydrobaccatin III is converted to 9-dihydrotaxol. Reference may be had to "Synthesis of 9-Dihydrotaxol: a Novel Bioactive Taxane" by L. L. Klein in Tetrahedron Lett. Vol 34, pp 2047-2050. An intermediate in this synthetic pathway is the dimethylketal of 9-dihydrotaxol.

[0261] In one embodiment, the procedure of Klein is followed with a carbonyl compound other than acetone to bind a wide variety of groups to the subject ketal. Supplemental discussion of C-9 analogs is found in "Synthesis of 9-Deoxotaxane Analogs" by L. L. Klein in Tetrahedron Lett. Vol 35, p 4707 (1994).

Attachment at C-10

[0262] In one embodiment of the invention, the C-10 position is functionalized using the procedure disclosed in U.S. Pat. No. 6,638,973. This patent teaches the synthesis of paclitaxel analogs that vary at the C-10 position. A sample of 10-deacetylbaccatin III was acylated by treatment with propionic anhydride. The C-13 sidechain was attached using standard lactam methodology after first performing a selective protection of the secondary alcohol at the C-7 position. In one embodiment of the invention, this procedure is adapted to allow access to a variety of C-10 analogues of paclitaxel.

[0263] In one embodiment an anhydride is used as an electrophile. In another embodiment, an acid halide is used. As would be apparent to one of ordinary skill in the art, a variety of electrophiles could be employed. Siderophores

[0264] In one embodiment, a member of the taxane family of compounds is attached to a magnetic carrier particle. Suitable carrier particles include siderophores (both iron and non-iron containing), nitroxides, as well as other magnetic carriers.

[0265] Siderophores are a class of compounds that act as chelating agents for various metals. Most organisms use siderophores to chelate iron (III) although other metals may be exchanged for iron (see, for example, Exchange of Iron by Gallium in Siderophores by Emergy, Biochemistry 1986, vol 25, pages 4629-4633). Most of the siderophores known to date are either catecholates or hydroxamic acids.

[0266] Representative examples of catecholate siderophores include the albomycins, agrobactin, parabactin, enterobactin, and the like.

[0267] Examples of hydroxamic acid-based siderophores include ferrichrome, ferricrocin, the albomycins, ferrioxamines, rhodotorulic acid, and the like. Reference may be had to Microbial Iron Chelators as Drug Delivery Agents by M. J. Miller et al., Acc. Chem. Res. 1993, vol 26, pp 241-249; Structure of Des(diserylglycyl)ferrirhodin, DDF, a Novel Siderophore from Aspergillus ochraceous by M. A. F. Jalal et al. , J. Org. Chem. 1985, vol 50, pp 5642-5645; Synthesis and Solution Structure of Microbial Siderophores by R. J. Bergeron, Chem. Rev. 1984, vol 84, pp 587-602; and Coordination Chemistry and Microbial Iron Transport by K. N. Raymond, Acc. Chem. Res., 1979, vol 12, pp 183-190. The synthesis of a retrohydroxamate analog of ferrichrome is described by R. K. Olsen et al. in J. Org. Chem. 1985, vol 50, pp 2264-2271.

[0268] In "Total Synthesis of Desferrisalmycin" (M. J. Miller et al. in J. Am. Chem. Soc. 2002, vol 124 pp 15001-15005), a natural product is synthesized that contains a siderophore. The author states "siderophores are functionally defined as low molecular mass molecules which acquire iron (III) from the environment and transport it into microganisms. Because of the significant roles they play in the active transport of physiologically essentially iron (III) through microbe cell members, it is not surprising that siderophores-drug conjugates are attracting more and more attention from both medicinal chemists and clinical researchers as novel drug delivery systems in the war against microbial infections, especially in an area of widespread emergency of multidrug-resistance (MDR) strains. There have been three families of compounds identified as natural siderophore-drug conjugates, including ferrimycin, albomycin, and salmycin." In a related paper, Miller describes the use of siderophores as drug delivery agents (Acc. Chem. Res. 1993, vol 26, pp 241-249. Presumably, the siderophore acts as a "sequestering agents [to] facilitate the active transport of chelated iron into cells where, by modification, reduction, or siderophore decomposition, it is released for use by the cell." Miller describes the process of tethering a drug to a sidrophore to promote the active transport of the drug across the cell membrane.

[0269] In "The Preparation of a Fully Differentiated `Multiwarhead` Sidrophore Precursor", by M. J. Miller et al (J. Org. Chem. 2003, vol 68, pp 191-194) a precursor is disclosed which allows for a drug to be tethered to a sidrophore. In one embodiment, the route disclosed by Miller is employed to provide a variety of siderophores of similar structure. The synthesis of similar hydroxamic acid-based siderophores is discussed in J. Org. Chem. 2000, vol 65 (Total Synthesis of the Siderophore Danoxamine by M. J. Miller et al.), pp 4833-4838 and in the J. of Med. Chem. 1991, vol 32, pp 968-978 (by M. J. Miller et al.).

[0270] A variety of fluorescent labels have been attached to ferrichrome analogues in "Modular Fluorescent-Labeled Siderophore Analogues" by A. Shanzer et al. in J. Med. Chem. 1998, vol 41, 1671-1678. The authors have developed a general methodology for such attachments.

[0271] As discussed above, functionalized ferrichrome analogs have been previous generated, usually using basic amine acids (glycine). In one embodiment, functionality is introduced using an alternative amine acid (such as serine) in place of the central glycine residue. This provides a functional group foothold from which to base a wide variety of analogs. Using traditional synthetic techniques, various linkers are utilized so as to increase or decrease the distance between the magnetic carrier and the drug.

[0272] As would be apparent to one of ordinary skill in the art, the above specified techniques are widely applicable to a variety of substrates. By way of illustration, and not limitation, a number of magnetic taxanes are shown below. Nitroxides

[0273] Another class of magnetic carriers is the nitroxyl radicals (also known as nitroxides). Nitroxyl radicals a "persistent" radials that are unusually stable. A wide variety of nitroxyls are commercially available. Their paramagnetic nature allows them to be used as spin labels and spin probes.

[0274] In addition to the commercially available nitroxyls, other paramagnetic radical labels have been generated by acid catalyzed condensation with 2-Amino-2-methyl-1-propanol followed by oxidation of the amine.

[0275] One of ordinary skill in the art could use the teachings of this specification to generate a wide variety of suitable carrier-drug complexes. The following table represents but a small sampling of such compounds. TABLE-US-00003 R1 R2 R3 R4 F1, Y=CH2, H Ac COPh n = 0 to 20 Ac F1, Y=CH2, Ac COPh n = 0 to 20 Ac H F1, Y=CH2, COPh n = 0 to 20 Ac H Ac F1, Y=CH2, n = 0 to 20 H H Ac Boc F1, Y=CH2, H Ac Boc n = 0 to 20 H F1, Y=CH2, Ac Boc n = 0 to 20 H H F1, Y=CH2, Boc n = 0 to 20 H H Ac F1, Y=CH2, n = 0 to 20 F1, Y=NH or H Ac COPh NR, n = 0 to 20 Ac F1, Y=NH or Ac COPh NR, n = 0 to 20 Ac H F1, Y=NH or COPh NR, n = 0 to 20 Ac H Ac F1, Y=NH or NR, n = 0 to 20 H H Ac Boc F1, Y=NH or H Ac Boc NR, n = 0 to 20 H F1, Y=NH or Ac Boc NR, n = 0 to 20 H H F1, Y=NH or Boc NR, n = 0 to 20 H H Ac F1, Y=NH or NR, n = 0 to 20 N1, n = 0 to 20 H Ac COPh Ac N1, n = 0 to 20 Ac COPh Ac H N1, n = 0 to 20 COPh Ac H Ac N1, n = 0 to 20 H H Ac Boc N1, n = 0 to 20 H Ac Boc H N1, n = 0 to 20 Ac Boc H H N1, n = 0 to 20 Boc H H Ac N1, n = 0 to 20 N2, H Ac COPh n = 0 to 20, X = O or NH Ac N2, n = 0 to 20, Ac COPh X = O or NH Ac H N2, n = 0 to 20, COPh X = O or NH Ac H Ac N2, n = 0 to 20, X = O or NH H H Ac Boc N2, H Ac Boc n = 0 to 20, X = O or NH H N2, n = 0 to 20, Ac Boc X = O or NH H H N2, n = 0 to 20, Boc X = O or NH H H Ac N2, n = 0 to 20, X = O or NH N3, H Ac COPh n = 0 to 20, X = O or NH Ac N3, n = 0 to 20, Ac COPh X = O or NH Ac H N3, n = 0 to 20, COPh X = O or NH Ac H Ac N3, n = 0 to 20, X = O or NH H H Ac Boc N3, H Ac Boc n = 0 to 20, X = O or NH H N3, n = 0 to 20, Ac Boc X = O or NH H H N3, n = 0 to 20, Boc X = O or NH H H Ac N3, n = 0 to 20, X = O or NH F2 or F3 H Ac COPh Ac F2 or F3 Ac COPh Ac H F2 or F3 COPh Ac H Ac F2 or F3 F2 or F3 H Ac Boc H F2 or F3 Ac Boc H H F2 or F3 Boc H H Ac F2 or F3

[0276] The prior disclosure illustrates how one may modify prior art taxanes to make them magnetic. As will be apparent to those skilled in the art, one may similarly modify other modifiable prior art anti-mitotic compounds to make them magnetic.

Other Modifiable Prior Art Compounds

[0277] Many anti-mitotic compounds that may be modified in accordance with the process of this invention are described in the prior art. One of these compounds is discodermolide; and it is described in U.S. Pat. No. 6,541,509, the entire disclosure of which is hereby incorporated by reference into this specification. Reference may be had, e.g., to column 10 of such paent and to the references 10, 11, 12, and 13 cited in such patent.

[0278] The reference 12 in U.S. Pat. No. 6,541,509 is to an article by R. J. Kowalski et al., "The Microtubule-Stabilizing Agent Discodermolide Competitively Inhibits the Binding of Paclitaxel(Taxol) to Tubulin Monomers, . . . " Mol. Pharacol. 52:613-22, 1997. At page 2 of the Kowalski et al. patent, a formula for discodermolide is presented with 29 numbered carbon atoms (see FIG. 1).

[0279] Elsewhere in this specification, applicants teach how to make "magnetic taxanes" by incorporating therein various linker groups and/or siderophores. The same linker groups and/or siderphores may be utilized via subsgtantially the same process to make the discodermolide magnetic in the same manner.

[0280] As is disclosed elsewhere in this specification, siderphores are a class of compounds that act as chelating agents for various metals. When used to make "magnetic taxanes," they are preferably bound to either the C7 and/or the C10 carbons of the paclitaxels. They can similarly be used to make "magnetic discodermolides," but in this latter case they should be bonded at the C17 carbon of discodermolide, to which a hydroxyl group is bound. The same linker that is used to link the C7/C10 carbon of the taxane to the siderphore may also be sued to link the C17 carbon of the discodermolde to the siderphore.

[0281] In one embodiment, the "siderohophoric group" disclosed in United States patent 6,310,058, the entire disclosure of which is hereby incorporated by reference into this specification, is utilized. The siderophoric group is of the formula --(CH2).sub.m--N(OH)--C(O)--(CH.sub.2)n -(CH.dbd.CH).sub.o--CH3, wherein m is an integer of from 2 to 6, n is 0 or an integer of from 1 to 22, and o is 0 or an integer 1 to 4, provided that m+o is no greater than 25.

[0282] In another embodiment, "magentic epothilone A" and/or "magentic epotilone B" is also made by a similar process. As is also disclosed in the FIG. 1 of the Kowalski et al. article (see page 614), and in the formula depicted, the epothilone A exists when, in such formula, the alkyl group ("R") is hydrogen, whereas the epothilone B exists when, in such formula, the alkyl group is methyl. In either case, one can make magnetic analogs of these compounds by using the same siderophores and the same linkers groups but utilzing them at a different site. One may bind such siderophores at either the number 3 carbon (which which a hydroxyl group is bound) and/or the number 7 carbon (to which another hydroxyl group is bound.).

[0283] Without wishing to be bound to any particular theory, applicants believe that the binding of the siderphores at the specified carbon sites imparts the required magnetic properties to such modified materials without adversely affecting the anti-mitotic properteis of the material. In fact, in some embodiment, the anti-mitotic properties of the modified magnetic materials surpass the anti-mitotic properties of the unmodified materials.

[0284] This is unexpected; for, if the same linker groups and/or siderophores are used to bind to other than the specified carbon atoms, materials with no or subtantially poorer anti-mitotic properties are produced.

[0285] Thus, e.g., and referring to the magnetic taxanes described elsewhere in this speficification (and also to FIG. 1 of the Kowalski et al. article), one should not link such siderphores to to any carbons on the pendant aromatic rings. Thus, e.g., and referring to the discodermolide structure, one shouldnot link siderphores to any of 1, 2, 3, or 4 carbon atoms. Thus, e.g., and referring to the epothilones, one should not link the siderphores to any carbonon the ring structure containing sulfur and nitrogen.

[0286] By way of further illustration, and referring to U.S. Pat. Nos. 5,504,074, 5,661,143, 5,892,069, 6,528,676, and 6,723,858 (the entire disclosure of each of which is hereby incorporated by reference into this specification), one may modify estradiol and estradiol metabolites to make them magnetic in accordance with the process of this invention. As is disclosed in U.S. Pat. No. 6,723,858 (the entire disclosure of which is hereby incorporated by reference into this specification, "Cell mitosis is a multi-step process that includes cell division and replication (Alberts, B. et al. In The Cell, pp. 652-661 (1989); Stryer, E. Biochemistry (1988)). Mitosis is characterized by the intracellular movement and segregation of organelles, including mitotic spindles and chromosomes. Organelle movement and segregation are facilitated by the polymerization of the cell protein tubulin. Microtubules are formed from .alpha. and .beta. tubulin polymerization and the hydrolysis of guanosine triphosphate (GTP). Microtubule formation is important for cell mitosis, cell locomotion, and the movement of highly specialized cell structures such as cilia and flagella."

[0287] As is also disclosed in U.S. Pat. No. 6,723,858, "Microtubules are extremely labile structures that are sensitive to a variety of chemically unrelated anti-mitotic drugs. For example, colchicine and nocadazole are anti-mitotic drugs that bind tubulin and inhibit tubulin polymerization (Stryer, E. Biochemistry (1988)). When used Cell mitosis is a multi-step process that includes cell division and replication (Alberts, B. et al. In The Cell, pp. 652-661 (1989); Stryer, E. Biochemistry (1988)). Mitosis is characterized by the intracellular movement and segregation of organelles, including mitotic spindles and chromosomes. Organelle movement and segregation are facilitated by the polymerization of the cell protein tubulin. Microtubules are formed from .alpha. and .beta. tubulin polymerization and the hydrolysis of guanosine triphosphate (GTP). Microtubule formation is important for cell mitosis, cell locomotion, and the movement of highly specialized cell structures such as cilia and flagella. Microtubules are extremely labile structures that are sensitive to a variety of chemically unrelated anti-mitotic drugs. For example, colchicine and nocadazole are anti-mitotic drugs that bind tubulin and inhibit tubulin polymerization (Stryer, E. Biochemistry (1988)). When used alone or in combination with other therapeutic drugs, colchicine may be used to treat cancer (WO-9303729-A, published Mar. 4, 1993; J 03240726-A, published Oct. 28, 1991), alter neuromuscular function, change blood pressure, increase sensitivity to compounds affecting sympathetic neuron function, depress respiration, and relieve gout (Physician's Desk Reference, Vol. 47, p.1487, (1993))."

[0288] As is also disclosed in U.S. Pat. No. 6,723,858, "Estradiol and estradiol metabolites such as 2-methoxyestradiol have been reported to inhibit cell division (Seegers, J. C. et al. J. Steroid Biochem. 32, 797-809 (1989); Lottering, M-L. et al. Cancer Res. 52, 5926-5923(1992); Spicer, L. J. and Hammond, J. M. Mol. and Cell. Endo. 64,119-126 (1989); Rao, P. N. and Engelberg, J. Exp. Cell Res. 48, 71-81 (1967)). However, the activity is variable and depends on a number of in vitro conditions. For example, estradiol inhibits cell division and tubulin polymerization in some in vitro settings (Spicer, L. J. and Hammond, J. M. Mol. and Cell. Endo. 64, 119-126 (1989); Ravindra, R., J. Indian Sci. 64 (c) (1983)), but not in others (Lottering, M-L. et al. Cancer Res. 52, 5926-5923 (1992); Ravindra, R., J. Indian Sci. 64 (c) (1983)). Estradiol metabolites such as 2-methoxyestradiol will inhibit cell division in selected in vitro settings depending on whether the cell culture additive phenol red is present and to what extent cells have been exposed to estrogen. (Seegers, J. C. et al. Joint NCI-IST Symposium. Biology and Therapy of Breast Cancer. Sep. 25, Sep. 27, 1989, Genoa, Italy, Abstract A 58). alone or in combination with other therapeutic drugs, colchicine may be used to treat cancer (WO-09303729-A, published Mar. 4, 1993; J 03240726-A, published Oct. 28, 1991), alter neuromuscular function, change blood pressure, increase sensitivity to compounds affecting sympathetic neuron function, depress respiration, and relieve gout (Physician's Desk Reference, Vol. 47, p. 1487, (1993)).

[0289] As is also disclosed in U.S. Pat. No. 6,723,858, estradiol and estradiol metabolites such as 2-methoxyestradiol have been reported to inhibit cell division (Seegers, J. C. et al. J. Steroid Biochem. 32, 797-809 (1989); Lottering, M-L. et al. Cancer Res. 52, 5926-5923(1992); Spicer, L. J. and Hammond, J. M. Mol. and Cell. Endo. 64, 119-126 (1989); Rao, P. N. and Engelberg, J. Exp. Cell Res. 48, 71-81 (1967)). However, the activity is variable and depends on a number of in vitro conditions. For example, estradiol inhibits cell division and tubulin polymerization in some in vitro settings (Spicer, L. J. and Hammond, J. M. Mol. and Cell. Endo. 64, 119-126 (1989); Ravindra, R., J. Indian Sci. 64 (c) (1983)), but not in others (Lottering, M-L. et al. Cancer Res. 52, 5926-5923 (1992); Ravindra, R., J. Indian Sci. 64 (c) (1983)). Estradiol metabolites such as 2-methoxyestradiol will inhibit cell division in selected in vitro settings depending on whether the cell culture additive phenol red is present and to what extent cells have been exposed to estrogen. (Seegers, J. C. et al. Joint NCI-IST Symposium. Biology and Therapy of Breast Cancer. Sep. 25, Sep. 27, 1989, Genoa, Italy, Abstract A 58).

[0290] In one preferred embodiment; the modifiable anti-mitotic agent is an anti-microtubule agent. In one aspect of this embodiment, and referring to U.S. Pat. No. 6,689,803 at columns 5-6 thereof (the entire disclosure of which patent is hereby incorporated by reference into this specification), representative anti-microtubule agents include, e.g., " . . . taxanes (e.g., paclitaxel and docetaxel), campothecin, eleutherobin, sarcodictyins, epothilones A and B, discodermolide, deuterium oxide (D.sub.2O), hexylene glycol (2-methyl-2,4-pentanediol), tubercidin (7-deazaadenosine), LY290181 (2-amino-4-(3-pyridyl)-4H-naphtho(1,2-b)pyran-3-cardonitrile), aluminum fluoride, ethylene glycol bis-(succinimidylsuccinate), glycine ethyl ester, nocodazole, cytochalasin B, colchicine, colcemid, podophyllotoxin, benomyl, oryzalin, majusculamide C, demecolcine, methyl-2-benzimidazolecarbamate (MBC), LY195448, subtilisin, 1069C85, steganacin, combretastatin, curacin, estradiol, 2-methoxyestradiol, flavanol, rotenone, griseofulvin, vinca alkaloids, including vinblastine and vincristine, maytansinoids and ansamitocins, rhizoxin, phomopsin A, ustiloxins, dolastatin 10, dolastatin 15, halichondrins and halistatins, spongistatins, cryptophycins, rhazinilam, betaine, taurine, isethionate, HO-221, adociasulfate-2, estramustine, monoclonal anti-idiotypic antibodies, microtubule assembly promoting protein (taxol-like protein, TALP), cell swelling induced by hypotonic (190 mosmol/L) conditions, insulin (100 nmol/L) or glutamine (10 mmol/L), dynein binding, gibberelin, XCHO1 (kinesin-like protein), lysophosphatidic acid, lithium ion, plant cell wall components (e.g., poly-L-lysine and extensin), glycerol buffers, Triton X-100 microtubule stabilizing buffer, microtubule associated proteins (e.g., MAP2, MAP4, tau, big tau, ensconsin, elongation factor-1-alpha (EF-1.alpha.) and E-MAP-115), cellular entities (e.g., histone H1, myelin basic protein and kinetochores), endogenous microtubular structures (e.g., axonemal structures, plugs and GTP caps), stable tubule only polypeptide (e.g., STOP145 and STOP220) and tension from mitotic forces, as well as any analogues and derivatives of any of the above. Within other embodiments, the anti-microtubule agent is formulated to further comprise a polymer."

[0291] The term "anti-microtubule," as used in this specification (and in the specification of U.S. Pat. No. 6,689,803), refers to any " . . . protein, peptide, chemical, or other molecule which impairs the function of microtubules, for example, through the prevention or stabilization of polymerization. A wide variety of methods may be utilized to determine the anti-microtubule activity of a particular compound, including for example, assays described by Smith et al. (Cancer Lett 79(2):213-219, 1994) and Mooberry et al., (Cancer Lett. 96(2):261-266, 1995);" see, e.g., lines 13-21 of column 14 of U.S. Pat. No. 6,689,803. One preferred method, utilizing the anti-mitotic factor, is described in this specification.

[0292] An extensive listing of anti-microtubule agents is provided in columns 14, 15, 16, and 17 of U.S. Pat. No. 6,689,803; and one or more of them may be modified them in accordance with the process of this invention to make them magnetic. These anti-microtubule agents include " . . . taxanes (e.g., paclitaxel (discussed in more detail below) and docetaxel) (Schiff et al., Nature 277: 665-667, 1979; Long and Fairchild, Cancer Research 54: 4355-4361, 1994; Ringel and Horwitz, J. Natl. Cancer Inst. 83(4): 288-291, 1991; Pazdur et al., Cancer Treat. Rev. 19(4): 351-386, 1993), campothecin, eleutherobin (e.g., U.S. Pat. No. 5,473,057), sarcodictyins (including sarcodictyin A), epothilones A and B (Bollag et al., Cancer Research 55: 2325-2333, 1995), discodermolide (ter Haar et al., Biochemistry 35: 243-250, 1996), deuterium oxide (D2O) (James and Lefebvre, Genetics 130(2): 305-314, 1992; Sollott et al., J. Clin. Invest. 95: 1869-1876, 1995), hexylene glycol (2-methyl-2,4-pentanediol) (Oka et al., Cell Struct. Funct. 16(2): 125-134, 1991), tubercidin (7-deazaadenosine) (Mooberry et al., Cancer Lett. 96(2): 261-266, 1995), LY290181 (2-amino-4-(3-pyridyl)-4H-naphtho(1,2-b)pyran-3-cardonitrile) (Panda et al., J. Biol. Chem. 272(12): 7681-7687, 1997; Wood et al., Mol. Pharmacol. 52(3): 437-444, 1997), aluminum fluoride (Song et al., J. Cell. Sci. Suppl. 14:147-150, 1991), ethylene glycol bis-(succinimidylsuccinate) (Caplow and Shanks, J. Biol. Chem. 265(15): 8935-8941, 1990), glycine ethyl ester (Mejillano et al., Biochemistry 31(13): 3478-3483, 1992), nocodazole (Ding et al., J. Exp. Med. 171(3): 715-727, 1990; Dotti et al., J. Cell Sci. Suppl. 15: 75-84, 1991; Oka et al., Cell Struct. Funct. 16(2): 125-134, 1991; Weimer et al., J. Cell. Biol. 136(1), 71-80, 1997), cytochalasin B (Illinger et al., Biol. Cell 73(2-3): 131-138, 1991), colchicine and CI 980 (Allen et al., Am. J. Physiol. 261(4 Pt. 1): L315-L321, 1991; Ding et al., J. Exp. Med. 171(3): 715-727, 1990; Gonzalez et al., Exp. Cell. Res. 192(1): 10-15, 1991; Stargell et al., Mol. Cell. Biol. 12(4): 1443-1450, 1992; Garcia et al., Antican. Drugs 6(4): 533-544, 1995), colcemid (Barlow et al., Cell. Motil. Cytoskeleton 19(1): 9-17, 1991; Meschini et al., J. Microsc. 176(Pt. 3): 204-210, 1994; Oka et al., Cell Struct. Funct. 16(2): 125-134, 1991), podophyllotoxin (Ding et al., J. Exp. Med. 171(3): 715-727, 1990), benomyl (Hardwick et al., J. Cell. Biol. 131(3): 709-720, 1995; Shero et al., Genes Dev. 5(4): 549-560, 1991), oryzalin (Stargell et al., Mol. Cell. Biol. 12(4): 1443-1450, 1992), majusculamide C (Moore, J. Ind. Microbiol. 16(2): 134-143, 1996), demecolcine (Van Dolah and Ramsdell, J. Cell. Physiol. 166(1): 49-56, 1996; Wiemer et al., J. Cell. Biol. 136(1): 71-80, 1997), methyl-2-benzimidazolecarbamate (MBC) (Brown et al., J. Cell. Biol. 123(2): 387-403, 1993), LY195448 (Barlow & Cabral, Cell Motil. Cytoskel. 19: 9-17, 1991), subtilisin (Saoudi et al., J. Cell Sci. 108: 357-367, 1995), 1069C85 (Raynaud et al., Cancer Chemother. Pharmacol. 35: 169-173, 1994), steganacin (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), combretastatins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), curacins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), estradiol (Aizu-Yokata et al., Carcinogen. 15(9): 1875-1879, 1994), 2-methoxyestradiol (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), flavanols (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), rotenone (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), griseofulvin (Hamel, Med. Res. Rev. 16(2): 207-231; 1996), vinca alkaloids, including vinblastine and vincristine (Ding et al., J. Exp. Med. 171(3): 715-727, 1990; Dirk et al., Neurochem. Res. 15(11): 1135-1139, 1990; Hamel, Med. Res. Rev. 16(2): 207-231, 1996; Illinger et al., Biol. Cell 73(2-3): 131-138, 1991; Wiemer et al., J. Cell. Biol. 136(1): 71-80, 1997), maytansinoids and ansamitocins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), rhizoxin (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), phomopsin A (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), ustiloxins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), dolastatin 10 (Hamel, Med Res. Rev. 16(2): 207-231, 1996), dolastatin 15 (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), halichondrins and halistatins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), spongistatins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), cryptophycins (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), rhazinilam (Hamel, Med. Res. Rev. 16(2): 207-231, 1996), betaine (Hashimoto et al., Zool. Sci. 1: 195-204, 1984), taurine (Hashimoto et al., Zool. Sci. 1: 195-204, 1984), isethionate (Hashimoto et al., Zool. Sci. 1: 195-204, 1984), HO-221 (Ando et al., Cancer Chemother. Pharmacol. 37: 63-69, 1995), adociasulfate-2 (Sakowicz et al., Science 280: 292-295, 1998), estramustine (Panda et al., Proc. Natl. Acad. Sci. USA 94:10560-10564, 1997), monoclonal anti-idiotypic antibodies (Leu et al., Proc. Natl. Acad. Sci. USA 91(22): 10690-10694, 1994), microtubule assembly promoting protein (taxol-like protein, TALP) (Hwang et al., Biochem. Biophys. Res. Commun. 208(3): 1174-1180, 1995), cell swelling induced by hypotonic (190 mosmol/L) conditions, insulin (100 nmol/L) or glutamine (10 mmol/L) (Haussinger et al., Biochem. Cell. Biol. 72(1-2): 12-19, 1994), dynein binding (Ohba et al., Biochim. Biophys. Acta 1158(3): 323-332, 1993), gibberelin (Mita and Shibaoka, Protoplasma 119(1/2): 100-109, 1984), XCHO1 kinesin-like protein) (Yonetani et al., Mol. Biol. Cell 7(suppl): 211A, 1996), lysophosphatidic acid (Cook et al., Mol. Biol. Cell 6(suppl): 260A, 1995), lithium ion (Bhattacharyya and Wolff, Biochem. Biophys. Res. Commun. 73(2): 383-390, 1976), plant cell wall components (e.g., poly-L-lysine and extensin) (Akashi et al., Planta 182(3): 363-369, 1990), glycerol buffers (Schilstra et al., Biochem. J. 277(Pt. 3): 839-847, 1991; Farrell and Keates, Biochem. Cell. Biol. 68(11): 1256-1261, 1990; Lopez et al., J. Cell. Biochem. 43(3): 281-291, 1990), Triton X-100 microtubule stabilizing buffer (Brown et al., J. Cell Sci. 104(Pt. 2): 339-352, 1993; Safiejko-Mroczka and Bell, J. Histochem. Cytochem. 44(6): 641-656, 1996), microtubule associated proteins (e.g., MAP2, MAP4, tau, big tau, ensconsin, elongation factor-1 -alpha EF-1.alpha.) and E-MAP-115) (Burgess et al., Cell Motil. Cytoskeleton 20(4): 289-300, 1991; Saoudi et al., J. Cell. Sci. 108(Pt. 1): 357-367, 1995; Bulinski and Bossler, J. Cell. Sci. 107(Pt. 10): 2839-2849, 1994; Ookata et al., J. Cell Biol. 128(5): 849-862, 1995; Boyne et al., J. Comp. Neurol. 358(2): 279-293, 1995; Ferreira and Caceres, J. Neurosci. 11(2): 392400, 1991; Thurston et al., Chromosoma 105(1): 20-30, 1996; Wang et al., Brain Res. Mol. Brain Res. 38(2): 200-208, 1996; Moore and Cyr, Mol. Biol. Cell 7(suppl): 221-A, 1996; Masson and Kreis, J. Cell Biol. 123(2), 357-371, 1993), cellular entities (e.g. histone H1, myelin basic protein and kinetochores) (Saoudi et al., J. Cell. Sci. 108(Pt. 1): 357-367, 1995; Simerly et al., J. Cell Biol. 111(4): 1491-1504, 1990), endogenous microtubular structures (e.g., axonemal structures, plugs and GTP caps) (Dye et al., Cell Motil. Cytoskeleton 21(3): 171-186, 1992; Azhar and Murphy, Cell Motil. Cytoskeleton 15(3): 156-161, 1990; Walker et al., J. Cell Biol. 114(1): 73-81, 1991; Drechsel and Kirschner, Curr. Biol. 4(12): 1053-1061, 1994), stable tubule only polypeptide (e.g., STOP145 and STOP220) (Pirollet et al., Biochim. Biophys. Acta 1160(1): 113-119, 1992; Pirollet et al., Biochemistry 31(37): 8849-8855, 1992; Bosc et al., Proc. Natl. Acad. Sci. USA 93(5): 2125-2130, 1996; Margolis et al., EMBO J. 9(12): 4095-4102, 1990) and tension from mitotic forces (Nicklas and Ward, J. Cell Biol. 126(5): 1241-1253, 1994), as well as any analogues and derivatives of any of the above. Such compounds can act by either depolymerizing microtubules (e.g., colchicine and vinblastine), or by stabilizing microtubule formation (e.g., paclitaxel)."

[0293] U.S. Pat. No. 6,689,803 also discloses (at columns 16 and 17 that, "Within one preferred embodiment of the invention, the anti-mitotic compound is paclitaxel, a compound which disrupts microtubule-formation by binding to tubulin to form abnormal mitotic spindles. Briefly, paclitaxel is a highly derivatized diterpenoid (Wani et al., J. Am. Chem. Soc. 93:2325, 1971) which has been obtained from the harvested and dried bark of Taxus brevifolia (Pacific Yew) and Taxomyces Andreanae and Endophytic Fungus of the Pacific Yew (Stierle et al., Science 60:214-216,-1993). "Paclitaxel" (which should be understood herein to include prodrugs, analogues and derivatives such as, for example, TAXOL.RTM., TAXOTERE.RTM., Docetaxel, 10-desacetyl analogues of paclitaxel and 3'N-desbenzoyl-3'N-t-butoxy carbonyl analogues of paclitaxel) may be readily prepared utilizing techniques known to those skilled in the art (see e.g., Schiff et al., Nature 277:665-667, 1979; Long and Fairchild, Cancer Research 54:4355-4361, 1994; Ringel and Horwitz, J. Natl. Cancer Inst. 83(4):288-291, 1991; Pazdur et al., Cancer Treat. Rev. 19(4):351 -386, 1993; WO9407882; WO9407881; WO9407880; WO9407876; WO9323555; WO9310076; WO94/00156; WO9324476; EP590267; WO9420089; U.S. Pat. Nos. 5,294,637; 5,283,253; 5,279,949; 5,274,137; 5,202,448; 5,200,534; 5,229,529; 5,254,580; 5,412,092; 5,395,850; 5,380,751; 5,350,866; 4,857,653; 5,272,171; 5,411,984; 5,248,796; 5,248,796; 5,422,364; 5,300,638; 5,294,637; 5,362,831; 5,440,056; 4,814,470; 5,278,324; 5,352,805; 5,411,984; 5,059,699; 4,942,184; Tetrahedron Letters 35(52):9709-9712, 1994; J. Med. Chem. 35:4230-4237, 1992; J. Med. Chem. 34:992-998, 1991; J. Natural Prod. 57(10):1404-1410, 1994; J. Natural Prod. 57(11):1580-1583, 1994; J. Am. Chem. Soc. 110:6558-6560, 1988), or obtained from a variety of commercial sources, including for example, Sigma Chemical Co., St. Louis, Mo. (T7402--from Taxus brevifolia)."

[0294] As is also disclosed in U.S. Pat. No. 6,689,893, "Representative examples of such paclitaxel derivatives or analogues include 7-deoxy-docetaxol, 7,8-cyclopropataxanes, N-substituted 2-azetidones, 6,7-epoxy paclitaxels, 6,7-modified paclitaxels, 10-desacetoxytaxol, 10-deacetyltaxol (from 10-deacetylbaccatin III), phosphonooxy and carbonate derivatives of taxol, taxol 2',7-di(sodium 1,2-benzenedicarboxylate, 10-desacetoxy-11,12-dihydrotaxol-10,12(18)-diene derivatives, 10-desacetoxytaxol, Protaxol(2'- and/or 7-O-ester derivatives), (2'- and/or 7-O-carbonate derivatives), asymmetric synthesis of taxol side chain, fluoro taxols, 9-deoxotaxane, (13-acetyl-9-deoxobaccatine III, 9-deoxotaxol, 7-deoxy-9-deoxotaxol, 10-desacetoxy-7-deoxy-9-deoxotaxol, Derivatives containing hydrogen or acetyl group and a hydroxy and tert-butoxycarbonylamino, sulfonated 2'-acryloyltaxol and sulfonated 2'-O-acyl acid taxol derivatives, succinyltaxol, 2'-.gamma.-aminobutyryltaxol formate, 2'-acetyl taxol, 7-acetyl taxol, 7-glycine carbamate taxol, 2'-OH-7-PEG(5000)carbamate taxol, 2'-benzoyl and 2',7-dibenzoyl taxol derivatives, other prodrugs (2'-acetyl taxol; 2',7-diacetyltaxol; 2'succinyltaxol; 2'-(beta-alanyl)-taxol); 2'gamma-aminobutyryltaxol formate; ethylene glycol derivatives of 2'-succinyltaxol; 2'-glutaryltaxol; 2'-(N,N-dimethylglycyl)taxol; 2'-(2-(N,N-dimethylamino)propionyl)taxol; 2'orthocarboxybenzoyl taxol; 2'aliphatic carboxylic acid derivatives of taxol, Prodrugs {2'(N,N-diethylaminopropionyl)taxol, 2'(N,N-dimethylglycyl)taxol, 7(N,N-dimethylglycyl)taxol, 2',7-di-(N,N-dimethylglycyl)taxol, 7(N,N-diethylaminopropionyl)taxol, 2',7-di(N,N-diethylaminopropionyl)taxol, 2'-(L-glycyl)taxol, 7-(L-glycyl)taxol, 2',7-di(L-glycyl)taxol, 2'-(L-alanyl)taxol, 7-(L-alanyl)taxol, 2',7-di(L-alanyl)taxol, 2'-(L-leucyl)taxol, 7-(L-leucyl)taxol, 2',7-di(L-leucyl)taxol, 2'-(L-isoleucyl)taxol, 7-(L-isoleucyl)taxol, 2',7-di(L-isoleucyl)taxol, 2'-(L-valyl)taxol, 7-(L-valyl)taxol, 2'7-di(L-valyl)taxol, 2'-(L-phenylalanyl)taxol, 7-(L-phenylalanyl)taxol, 2',7-di(L-phenylalanyl)taxol, 2'-(L-prolyl)taxol, 7-(L-prolyl)taxol, 2',7-di(L-prolyl)taxol, 2'-(L-lysyl)taxol, 7-(L-lysyl)taxol, 2',7-di(L-lysyl)taxol, 2'-(L-glutamyl)taxol, 7-(L-glutamyl)taxol, 2',7-di(L-glutamyl)taxol, 2'-(L-arginyl)taxol, 7-(L-arginyl)taxol, 2',7-di(L-arginyl)taxol}, Taxol analogs with modified phenylisoserine side chains, taxotere, (N-debenzoyl-N-tert-(butoxycaronyl)-10-deacetyltaxol, and taxanes (e.g., baccatin III, cephalomannine, 10-deacetylbaccatin III, brevifoliol, yunantaxusin and taxusin)."

[0295] By way of yet further illustration, one may use one or more of the anti-mitotic agents disclosed in U.S. Pat. No. 6,673,937 (syntheses and methods of use of new antimitotic agents), U.S. Pat. No. 6,624,317 (taxoid conjugates as antimitotoic and antitumor agents), U.S. Pat. No. 6,593,334 (camptothecin-taxoid conjugates as antimitotic and antitumor agents), U.S. Pat. No. 6,593,321 (2-alkoxyestradiiol analogs with antiproliferative and antimitotic activity), U.S. Pat. No. 6,569,870 (fluorinated quinolones as antimitotic and antitumor agent), U.S. Pat. No. 6,528,489 (mycotoxin derivatives as antimitotic agents), 6,392,055 (synthesis and biological evaluation of analogs of the antimitotic marine natural product curacin A), U.S. Pat. No. 6,127,377 (vinka alkaloid antimitotic halogenated derivatives), U.S. Pat. No. 5,695,950 (method of screening for antimitotic compounds using the cdc25 tyrosine phosphatase), U.S. Pat. No. 5,620,985 (antimitotic binary alkaloid derivatives from catharanthus roseus), U.S. Pat. No. 5,294,538 (method of screening for antimitotic compounds using the CDC tyrosine phosphatase), and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0296] As will be apparent, one or more of the aforementioned anti-mitotic and/or anti-microtubule agents may be modified to make them magnetic in accordance with this invention.

Synergistic Combinations of Magnetic Anti-Mitotic Agents

[0297] In one embodiment of this invention, discussed elsewhere in this specification, a synergistic combination of the magnetic anti-mititoic compound of this invention and paclitaxel is described. In the embodiment of the invention described in this section of the specification, a synergitic combination of two or more anti-mititoic compounds is described.

[0298] In one embodiment, the first anti-mitotic compound is preferably a magentic taxane such as, e.g., magentic paclitaxel and/ormagnetic docetaxel. In this embodiment, the second anti-mitotic compound may be magnetic discdermolide, and/or magnetic epothilone A, and/or magentic epothilone B, and/or mixtures thereof. Other suitable combinations of magnetic anti-mitotic agents will be apparent.

Properties of the Preferred Anti-Mitotic Compounds

[0299] In one preferred embodiment, the compound of this invention has a mitotic index factor of at least about 10 percent and, more preferably, at least about 20 percent. In one aspect of this embodiment, the mitotic index factor is at least about 30 percent. In another embodiment, the mitotic index factor is at least about 50 percent.

[0300] In another embodiment of the invention, the compound of this invention has a mitotic index factor of less than about 5 percent.

[0301] As is known to those skilled in the art, the mitotic index is a measure of the extent of mitosis. Reference may be had, e.g., to U.S. Pat. No. 5,262,409 (binary tumor therapy), U.S. Pat. No. 5,443,962 (methods of indentifying inhibitors of cdc25 phosphatase), U.S. Pat. No. 5,744,300 (methods and reagents for the indentificatioin and regulation of senescence-related genes), U.S. Pat. Nos. 6,613,318, 6,251,585 (assay and reagents for indentifying anti-proliferative agents), U.S. Pat. No. 6,252,058 (sequences for targeting metastatic cells), U.S. Pat. No. 6,387,642 (method for indentifying a reagent that modulates Myt1 activity), U.S. Pat. No. 6,413,735 (method of screening for a modulator of angiogenesis), U.S. Pat. No. 6,531,479 (anti-cancer compounds), U.S. Pat. No. 6,599,694 (method of characterizing potential therapeutics by determining cell-cell interactions), U.S. Pat. No. 6,620,403 (in vivo chemosensitivity screen for human tumors), U.S. Pat. No. 6,699,854 (anti-cancer compounds), U.S. Pat. No. 6,743,576 (database system for predictive cellular bioinformatics), and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0302] Reference may also be had, e.g., to U.S. Pat. No. 5,262,409, which discloses that: "Determination of mitotic index: For testing mitotic blockage with nocodazole and taxol, cells were grown a minimum of 16 hours on polylysinecoated glass coverslips before drug treatment. Cells were fixed at intervals, stained with antibodies to detect lamin B, and counterstained with propidium iodide to assay chromosome condensation. To test cell cycle blocks in interphase, cells were synchronized in mitosis by addition of nocodazole (Sigma Chemical Co.) to a final concentration of 0.05 .mu.g/ml from a 1 mg/ml stock in dimethylsulfoxide. After 12 hours arrest, the mitotic subpopulation was isolated by shakeoff from the culture plate. After applying cell cycle blocking drugs and/or 2-AP, cells were fixed at intervals, prepared for indirect immunofluorescence with anti-tubulin antibodies, and counterstained with propidium iodide. All data timepoints represent averages of three counts of greater than 150 cells each. Standard deviation was never more than 1.5% on the ordinate scale."

[0303] Reference may be had, e.g., to U.S. Pat. No. 6,413,735 which discloses that: "The mitotic index is determined according to procedures standard in the art. Keram et al., Cancer Genet. Cytogenet. 55:235 (1991). Harvested cells are fixed in methanol:acetic acid (3:1, v:v), counted, and resuspended at 106 cells/ml in fixative. Ten microliters of this suspension is placed on a slide, dried, and treated with Giemsa stain. The cells in metaphase are counted under a light microscope, and the mitotic index is calculated by dividing the number of metaphase cells by the total number of cells on the slide. Statistical analysis of comparisons of mitotic indices is performed using the 2-sided paired t-test."

[0304] By means of yet further illustration, one may measure the mitotic index by means of the procedures described in, e.g., articles by Keila Torres et al. ("Mechanisms of Taxol-Induced Cell Death are Concentration Dependent," Cancer Research 58, 3620-3626, Aug. 15, 1998), and Jie-Gung Chen et al. ("Differential Mitosis Responses to Microtubule-stabilizing and destablilizng Drugs," Cancer Research 62, 1935-1938, Apr. 1, 2002).

[0305] The mitotic index is preferably measured by using the well-known HeLa cell lines. As is known to those skilled in the art, HeLa cells are cells that have been derived from a human carcinoma of the cervix from a patient named Henrietta Lack; the cells have been maintained in tissued culture since 1953.

[0306] Hela cells are described, e.g., in U.S. Pat. No. 5,811,282 (cell lines useful for detection of human immunodeficiency virus), U.S. Pat. No. 5,376,525 (method for the detectioin of mycoplasma), U.S. Pat. Nos. 6,143,512, 6,326,196, 6,365,394 (cell lines and constructs useful in production of E-1 deleted adenoviruses), U.S. Pat. No. 6,440,658 (assay method for determining effect on aenovirus infection of Hela cells), U.S. Pat. No. 6,461,809 (method of improving inflectivity of cells for viruses), U.S. Pat. Nos. 6,596,535, 6,605,426, 6,610,493 (screening compounds for the ability to alter the production of amyloid-beta-peptide), U.S. Pat. No. 6,699,851 (cytotoxic compounds and their use), and the like; the entire disclosure of each of these United States patents is hereby incorporated by reference into this specification. By way of illustration, U.S. Pat. No. 6,440,658 discloses that, for the experiments described in such patent, "The HeLa cell line was obtained from the American Type Culture Collection, Manassas Va."

[0307] In one preferred embodiment, the mitotic index of a "control cell line" (i.e., one that omits that drug to be tested) and of a cell line that includes 50 nanomoles of such drug per liter of the cell line are determined and compared. The "mitotic index factor" is equal to (Mt-Mc/Mc).times.100, wherein Mc is the mitotic index of the "control cell line," and Mt is the mitotic index of the cell line that includes the drug to be tested.

[0308] The compound of this invention preferably has a molecular weight of at least about 150 grams per mole. In one embodiment, the molecular weight of such compound is at least 300 grams per mole. In another embodiment, the molecular weight of such compound is 400 grams per mole. In yet another embodiment, the molecular weight of such compound is at least about 550 grams per mole. In yet another embodiment, the molecular weight of such compound is at least about 1,000 grams per mole. In yet another embodiment, the molecular weight of such compound is at least 1,200 grams per mole.

[0309] The compound of this invention preferably has a positive magnetic susceptibility of at least 1,000.times.10.sup.-6 centimeter-gram-seconds (cgs). As is known to those skilled in the art, magnetic susceptibility is the ratio of the magnetization of a material to the magnetic filed strength. Reference may be had, e.g., to U.S. Pat. No. 3,614,618 (magnetic susceptibility tester), U.S. Pat. No. 3,644,823 (nulling coil apparatus for magnetic susceptibility logging), U.S. Pat. No. 3,657,636 (thermally stable coil assembly for magnetic susceptibility logging), U.S. Pat. No. 3,665,297 (apparatus for determining magnetic susceptibility in a controlled chemical and thermal environment), U.S. Pat. No. 3,758,847 (method and system with voltage cancellation for measuring the magnetic susceptibility of a subsurface earth formation), U.S. Pat. No. 3,758,848 (magnetic susceptibility well logging system), U.S. Pat. No. 3,879,658 (apparatus for measuring magnetic susceptibility), U.S. Pat. No. 3,890,563 (magnetic susceptibility logging apparatus for distinguishing ferromagnetic materials), U.S. Pat. No. 3,980,076 (method for measuring externally of the human body magnetic susceptibility changes), U.S. Pat. No. 4,079,730 (apparatus for measuring externally of the human body magnetic susceptibility changes), U.S. Pat. No. 4,277,750 (induction probe for the measurement of magnetic susceptibility), U.S. Pat. No. 4,359,399 (taggands with induced magnetic susceptibility), U.S. Pat. No. 4,507,613 (method for identifying non-magnetic minerals in earth formations utilizing magnetic susceptibility measurements), U.S. Pat. No. 4,662,359 (use of magnetic susceptibility probes in the treatment of cancer), U.S. Pat. No. 4,701,712 (thermoregulated magnetic susceptibility sensor assembly), U.S. Pat. No. 5,233,992 (MRI method for high liver iron measurement using magnetic susceptibility induced field distortions), U.S. Pat. No. 6,208,884 (noninvasive room temperature instrument to measure magnetic susceptibility variations in body tissue), U.S. Pat. No. 6,321,105 (contrast agents with high magnetic susceptibility), U.S. Pat. No. 6,477,398 (resonant magnetic susceptibility imaging), and the like. The entire disclosure of each of these United States patent applications is hereby incorporated by reference into this specification.

[0310] In one embodiment, the compound of this invention has a positive magnetic susceptibility of at least 5,000.times.10.sup.-6 cgs. In another embodiment, such compound has a positive magnetic susceptibility of at least 10,000.times.10.sup.-6 cgs.

[0311] The compound of this invention is preferably comprised of at least 7 carbon atoms and, more preferably, at least about 10 carbon atoms. In another embodiment, such compound is comprised of at least 13 carbon atoms and at least one aromatic ring; in one aspect of this embodiment, the compound has at least two aromatic rings. In another embodiment, such compound is comprised of at least 17 carbon atoms.

[0312] In one embodiment, the compound of this invention is comprised of at least one oxetane ring. As is disclosed, e.g., on page 863 of N. Iving Sax's "Hawley's Condensed Chemical Dictionary," Eleventh Edition (Van Nostrand Reinhold Company, New York, N.Y., 1987), the oxetane group, also known as "trimethylene oxide), is identified by chemical abstract number CAS: 503-30-0. The oxetane group present in the preferred compound preferably is unsubstituted. In one embodiment, however, one ore more of the ring carbon atoms (either carbon number one, or carbon number two, or carbon number 3), has one or more of its hydrogen atoms substituted by a halogen group (such as chlorine), a lower alkyl group of from 1 to 4 carbon atoms, a lower haloalkyl group of from 1 to 4 carbon atoms, a cyanide group (CN), a hydroxyl group, a carboxyl group, an amino group (wich can be primary, secondary, or teriarary and may also contain from 0 to 6 carbon atoms), a substituted hydroxyl group (such as, e.g., an ether group containing from 1 to 6 carbon atoms), and the like. In one aspect of this embodiment, the substituted oxetane group is 3,3-bis (chlormethyl) oxetane.

[0313] In one embodiment, the compound of this invention is comprised of from about 1 to 10 groups of the formula --OB, in which B is selected from the group consisting of hydrogen, alkyl of from about 1 to about 5 carbon atoms, and a moiety of the formula R--(C.dbd.O)--O--, wherein R is selected from the group consisting of hydrogen and alkyl of from about 1 to about 6 cabon atoms, and the carbon is bonded to the R moiety, to the double-bonded oxygen, and to the single bonded oxygen, thereby forming what is commonly known as an acetyl group. This acetyl group preferably is linked to a ring structure that is unsaturated and preferably contains from about 6 to about 10 carbon atoms.

[0314] In one embodiment, the compound is comprised of two unsaturated ring structures linked by an amide structure, which typically has an acyl group, --CONR.sub.1--, wherein R.sub.1 is selected from the group consisting of hydrogen lower alkyl of from 1 to about 6 carbon atoms. In one preferred embodiment, the N group is bonded to both to the R.sub.1 group and also to radical that contains at least about 20 carbon atoms and at least about 10 oxygen atoms.

[0315] In one embodiment, the compound of this invention contains at least one saturated ring comprising from about 6 to about 10 carbon atoms. By way of illustration, the saturated ring structures may be one or more cyclohexane rings, cyclopheptane rings, cyclooctane rings, cylclononane rings, and/or cylcodecane rings. In one preferred aspect of this embodiment, at least one saturated ring in the compound is bonded to at least one quinine group. Referring to page 990 of the "Hawley's Condensed Chemical Dictionary" described elsewhere in this specification, quinine is 1,4-benzoquinone and is identified as "CAS: 106-51-4."

[0316] In one embodiment, the compound of this invention may comprise a ring structure with one double bond or two double bonds (as opposed to the three double bonds in the aromatic structures). These ring structures may be a partially unsaturated material selected from the group consisting of partially unsaturated cyclohexane, partially unsaturated cyclopheptane, partially unsaturated cyclooctane, partially unstaruated cyclononane, partially unsaturated cyclodecane, and mixtures thereof.

[0317] The compound of this invention is also preferably comprised of at least one inorganic atom with a positive magnetic susceptibility of at least 200.times.10.sup.-6 cgs. Thus, and referring to the "CRC Handbook of Chemistry and Physics," 63.sup.rd Edition (CRC Press, Inc., Boca Raton, Fla., 1982-83), the magnetic susceptibility of elements are described at pages E-118 to E-123. Suitable inorganic (i.e., non-carbon containing) elements with a positive magnetic susceptibility greater than about 200.times.10.sup.-6 Cgs include, e.g., cerium (+5,160.times.10.sup.-6 Cgs), cobalt (+11,000.times.10.sup.-6 cgs), dysprosium (+89,600.times.10.sup.-6 cgs), europium (+34,000.times.10.sup.-6 cgs), gadolinium (+755,000.times.10.sup.-6 cgs), iron (+13,600.times.10.sup.-6 cgs), manganese (+529.times.10.sup.-6 cgs), palladium (+567.4.times.10.sup.-6 cgs), plutonium (+610.times.10.sup.-6 cgs), praseodymium (+5010.times.10.sup.-6 cgs), samarium (+2230.times.10.sup.-6 cgs), technetium (+250.times.10.sup.-6 cgs), thulium (+51,444.times.10.sup.-6 cgs), and the like. In one embodiment, the positive magnetic susceptibility of such element is preferably greater than about +500.times.10.sup.-6 cgs and, even more preferably, greater than about +1,000.times.10.sup.-6 cgs.

[0318] In one preferred compound, the inorganic atom is radioactive. As is known to those skilled in the art, radioactivity is a phenomenon characterized by spontaneous disintegration of atomic nuclei with emission of corpuscular or electromagnetic radiation.

[0319] In another preferred embodiment, one or more inorganic or organic atoms that do not have the specified degree of magnetic suscpeptibility are radioactive. Thus, e.g., the radioactive atom may be, .e.g, radioactive carbon, radioactive hydrogen (tritium), radioactive phosphorus, radioactive sulfur, radioactive potassium, or any other of the atoms that exist is radioactive isotope form.

[0320] One preferred class of atoms is the class of radioactive nuclides. As is known to those skilled in the art, radioactive nuclides are atoms disintegrate by emission of corpuscular or electromagnetic radiatons. The rays most commonly emitted are alpha or beta gamma rays. See, e.g., page F-109 of the aforementioned "CRC Handbook of Chemistry and Physics."

[0321] Radioactive nuclides are well known and are described, e.g., in U.S. Pat. No. 4,355,179 (radioactive nuclide labeled propiophenone compounds), U.S. Pat. No. 4,625,118 (device for the elution and metering of a radioactive nuclide), U.S. Pat. No. 5,672,876 (method and apparatus for measuring distribution of radioactive nuclide in a subject), and U.S. Pat. No. 6,607,710 (bisphosphonic acid derivative and compound thereof labeled with radioactive nuclide.). The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0322] Referring again to the aforementioned "CRC Handbook of Chemistry and Physics," and to pages and in particular to pages B340-B378 thereof, it will be seen that the inorganic atom may be, e.g., cobalt 53, cobalt 54, cobalt 55, cobalt 56, cobalt 57, cobalt 58, cobalt 59, cobalt 60, cobalt 61, cobalt 62, cobalt 63, gadolinium 146, iron 49, iron 51, iron 52, iron 53, iron 54, iron 57, iron 58, iron 59, iron 60, iron 61, iron 62, manganese 50, praseodymium 135, samarium 156, and the like.

[0323] The compound of this invention preferably has a magnetic moment of at least about 0.5 Bohr magnetrons per molecule and, more preferably, at least about 1.0 Bohr magnetrons per molecule. In one embodiment, the compound has a magnetic moment of at least about 2 Bohr magnetrons per molecule.

[0324] As is known to those skilled in the art, a Bohr magnetron is the amount he/4(pi)mc, wherein he is Plank's constant, e and m are the charge and mass of the electron, c is the speed of light, and pi is equal to about 3.14567. Reference may be had, e.g., to U.S. Pat. Nos. 4,687,331, 4,832,877, 4,849,107, 5,040,373 ("(One Bohr magnetron is equal to 9.273.times.10-24 Joules/Tesla"), U.S. Pat. Nos. 5,169,944, 5,323,227 (".mu.o is a constant known as the Bohr magnetron at 9.274.times.10-21 erg/Gauss"), U.S. Pat. Nos. 5,352,979; 6,383,597; 6,725,668; 6,739,137 ("One Bohr magnetron .mu.B is equal to 9.273.times.10-24 Joules/Tesla"), and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0325] In one preferred embodiment, the magnetic compound of this invention is water soluble. As is known to those skilled in the art, solubility of one liquid or solid in another is the mass of the substance cotnained in a solution which is in equilibrium with an excess of the substance. Under such conditions, the solution is said to be saturated. Reference may be had, e.g., to page F-95 of the CRC "Handbook of Chemistry and Physics," 53.sup.rd Edition (The Chemical Rubber Company, CRC Press Division, 18901 Cranwood Parkway, Cleveland, Ohio, 44128, 1972-1973).

[0326] As used in this specification, the term "water soluble" refers to a solubility of at least 10 micrograms per milliliter and, more preferably, at least 100 micrograms per milliliter; by way of comparison, the solubility of paclitaxel in water is only about 0.4 micrograms per milliliter. One may determine water solubulity by conventional means. Thus, e.g., one may mix 0.5 milliters of water with the compound to be tested under ambient conditions, stir for 18 hours under ambient conditions, filter the slurry thus produced to remove the non-solubulized portion of the fitrand, and calculae how much ofthe filtrand was solubilized. From this, one can determine the number of micrograms that went into solution.

[0327] In one embodiment, the magnetic compound of this invention has a water solubility of at least 500 micrograms per milliliter, and more preferably at least 1,000 micrograms per milliliter. In yet another embodiment, the magnetic compound of this invention has a water solubility of at least 2500 micrograms per milliliter. In yet another embodiment, the magnetic compound of this invention has a water solubility of at least 5,000 micrograms per milliliter. In yet another embodiment, the magnetic compound of this invention has a water solubility of at least 10,000 micrograms per milliliter.

[0328] In another embodiment, the magnetic compound of this invention has a water solubility of less than about 10 micrograms per milliliter and, preferably, less than about 1.0 micrograms per milliliter.

[0329] Without wishing to be bound to any particular theory, applicants believe that the presence of a hydrophilic group in the compound of their invention helps render such compound water-soluble. Thus, e.g., it is believed that the siderophore group that is present in their preferred compounds aids in creating such water-solubility. As is known to those skilled in the art, a siderophe is one of a number of low molecular weight, iron-containing, or iron binding organic compounds or groups. Siderophores have a storng affinity for Fe.sup.3+ (which they chelate) and function in the solubilization and transport of iron. Siderophores are classified as belonging to either the phenol-catechol type (such as enterobactin and agrobactin), or the hydroxyamic acid type (such as ferrichome and mycobactin). Reference may be had, e.g., to page 442 of J. Stenesh's "Dictionary of Biochemistry and Molecular Biology," Second Edition (John Wiley & Sons, New York, N.Y., 1989).

[0330] In one preferred embodiment, the compound of this invention is comprised of one or more siderophore groups bound to a magnetic moiety (such as, e.g., an atom selected from the group consisting of iron, cobalt, nickel, and mixtures thereof).

[0331] As will be apparent, the inclusion of other hydrophilic groups into otherwise water-insoluble compounds is contemplated. Thus, by way of illustration and not limitation, and in place of or in addition to such siderophore group, one use hydrophilic groups such as the siderophore group(s) described hereinabove, hydroxyl groups, carboxyl groups, amino groups, organometallic ionic structures, phosphate groups, and the like. In one preferred aspect of this embodiment, the hydrophilic group utilized should preferably be biologically inert.

[0332] In one embodiment, the magnetic compound of this invention has an association rate with microtubules of at least 3,500,000/mole/second. The association rate may be determined in accordance with the procedure described in an article by J. F. Diaz et al., "Fast Kinetics of Taxol Binding to Microtubules," Journal of Biological Chemistry, 278(10) 8407-8455. Reference also may be had, e.g., to a paper by J. R. Strobe et al. appearing in the Journal of Biological Chemistry, 275: 26265-26276 (2000). As is disclosed, e.g., in the Diaz et al. paper, "The kinetics of binding and dissociation of Flutax-1 and Flutax-2 were measured by thechange of fluorescence intensity using an SS-51 stopped flow device (High-Tech Scientific, UK) equipped with a fluorescence detetion system, using an excitation wavelenght of 492 and a 530-nmcut-off filter in the emission pathway. Thefitting of the kinetic curves was done with a non-linear least squares sfitting program based upon the Marquardt algorithm . . . where pseudo-firt order conditions were used . . . ."

[0333] In another embodiment of the invention, the magnetic compound of this invention has a dissociation rate with microubules, as measured in accordance with the procedure desribed in such Diaz et al. paper, of less than about 0.08/second, when measured at a temperature of 37 degrees Celsius and under atmospheric conditions. Thus, in this embodiment, the magnetic compound of this invention binds more durably to microtubules than does paclitaxel, which has a dissociation rate of at least 0.91/second.

[0334] In one embodiment, the dissociation rate of the magnetic compound of this invention is less than 0.7/second and, more preferably, less than 0.6/second.

[0335] In one embodiment of this invention, the anti-mitotic compound of the invention has the specified degree of water-solubility and of anti-mitotic activity but does not necessarily possess one or more of the magnetic properties described hereinabove.

Other Magnetic Compounds

[0336] In another embodiment of this invention, other compounds which are not necessarily anti-mitotic are made magnetic by a process comparable to the process described in this specification for making taxanes magnetic.

[0337] In this embodiment, it is preferred to make "magnetic derivatives" of drugs and therapeutic agents. These derivative compounds each preferably have a molecular weight of at least 150 grams per mole, a positive magnetic susceptibility of at least 1,000.times.10.sup.-6 cgs, and a magnetic moment of at least 0.5 bohr magnetrons, wherein said compound is comprised of at least 7 carbon atoms and at least one inorganic atom with a positive magnetic susceptibility of at least 200.times.10.sup.-6 cgs.

[0338] Some of the preferred "precursors" used to make these "derivative compounds" are described in the remainder of this section of the specification.

[0339] The precursor materials may be either proteinaceous or non-proteinaceous drugs, as they terms are defined in U.S. Pat. No. 5,194,581, the entire disclosure of which is hereby incorporated by reference into this specification. U.S. Pat. No. 5,194,581 discloses "The drugs with which can be incorporated in the compositions of the invention include non-proteinaceous as well as proteinaceous drugs. The term "non-proteinaceous drugs" encompasses compounds which are classically referred to as drugs such as, for example, mitomycin C, daunorubicin, vinblastine, AZT, and hormones. Similar substances are within the skill of the art. The proteinaceous drugs which can be incorporated in the compositions of the invention include immunomodulators and other biological response modifiers. The term "biological response modifiers" is meant to encompass substances which are involved in modifying the immune response in such manner as to enhance the particular desired therapeutic effect, for example, the destruction of the tumor cells. Examples of immune response modifiers include such compounds as lymphokines. Examples of lymphokines include tumor necrosis factor, the interleukins, lymphotoxin, macrophage activating factor, migration inhibition factor, colony stimulating factor and the interferons. Interferons which can be incorporated into the compositions of the invention include alpha-interferon, beta-interferon, and gamma-interferon and their subtypes. In addition, peptide or polysaccharide fragments derived from these proteinaceous drugs, or independently, can also be incorporated. Also, encompassed by the term "biological response modifiers" are substances generally referred to as vaccines wherein a foreign substance, usually a pathogenic organism or some fraction thereof, is used to modify the host immune response with respect to the pathogen to which the vaccine relates. Those of skill in the art will know, or can readily ascertain, other substances which can act as proteinaceous drugs."

[0340] The precursor may be a lectin, as is disclosed in U.S. Pat. No. 5,176,907, the entire disclosure of which is hereby incorporated by reference into this specification. This United States patent discloses "Lectins are proteins, usually isolated from plant material, which bind to specific sugar moieties. Many lectins are also able to agglutinate cells and stimulate lymphocytes. Other therapeutic agents which can be used therapeutically with the biodegradable compositions of the invention are known, or can be easily ascertained, by those of ordinary skill in the art."

[0341] The precursor material may be an amorphous water-soluble pharmaceutical agent, as is disclosed in U.S. Pat. No. 6,117,455, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in the abstract of this patent, there is provided "A sustained-release microcapsule contains an amorphous water-soluble pharmaceutical agent having a particle size of from 1 nm-10 .mu.m and a polymer. The microcapsule is produced by dispersing, in an aqueous phase, a dispersion of from 0.001-90% (w/w) of an amorphous water-soluble pharmaceutical agent in a solution of a polymer having a wt. avg. molecular weight of 2,000-800,000 in an organic solvent to prepare an s/o/w emulsion and subjecting the emulsion to in-water drying."

[0342] In one embodiment, and referring to U.S. Pat. No. 5,420,105 (the entire disclosure of which is hereby incorporated by reference into this specification), the precursor material is selected from the group consisting of an anti-cancer anthracycline antibiotic, cis-platinum, methotrexate, vinblastine, mitoxanthrone ARA-C, 6-mercaptopurine, 6-mercaptoguanosine, mytomycin C and a steroid.

[0343] By way of further illustration, the precursor material is selected from the group consisting of antithrombogenic agents, antiplatelet agents, prostaglandins, thrombolytic drugs, antiproliferative drugs, antirejection drugs, antimicrobial drugs, growth factors, and anticalcifying agents.

[0344] By way of yet further illustration, the precursor material may, e.g., be any one or more of the therapeutic agents disclosed in column 5 of U.S. Pat. No. 5,464,650. Thus, and referring to such column 5, "The therapeutic substance used in the present invention could be virtually any therapeutic substance which possesses desirable therapeutic characteristics for application to a blood vessel. This can include both solid substances and liquid substances. For example, glucocorticoids (e.g. dexamethasone, betamethasone), heparin, hirudin, tocopherol, angiopeptin, aspirin, ACE inhibitors, growth factors, oligonucleotides, and, more generally, antiplatelet agents, anticoagulant agents, antimitotic agents, antioxidants, antimetabolite agents, and anti-inflammatory agents could be used. Antiplatelet agents can include drugs such as aspirin and dipyridamole. Aspirin is classified as an analgesic, antipyretic, anti-inflammatory and antiplatelet drug. Dypridimole is a drug similar to aspirin in that it has anti-platelet characteristics. Dypridimole is also classified as a coronary vasodilator. Anticoagulant agents can include drugs such as heparin, coumadin, protamine, hirudin and tick anticoagulant protein. Antimitotic agents and antimetabolite agents can include drugs such as methotrexate, azathioprine, vincristine, vinblastine, fluorouracil, adriamycin and mutamycin."

[0345] The precurors material may be one or more of the drugs disclosed in U.S. Pat. No. 5,599,352, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in this patent, "Examples of drugs that are thought to be useful in the treatment of restenosis are disclosed in published international patent application WO9112779 "Intraluminal Drug Eluting Prosthesis" which is incorporated herein by reference. Therefore, useful drugs for treatment of restenosis and drugs that can be incorporated in the fibrin and used in the present invention can include drugs such as anticoagulant drugs, antiplatelet drugs, antimetabolite drugs, anti-inflammatory drugs and antimitotic drugs. Further, other vasoreactive agents such as nitric oxide releasing agents could also be used . . . . By this method, drugs such as glucocorticoids (e.g. dexamethasone, betamethasone), heparin, hirudin, tocopherol, angiopeptin, aspirin, ACE inhibitors, growth factors, oligonucleotides, and, more generally, antiplatelet agents, anticoagulant agents, antimitotic agents, antioxidants, antimetabolite agents, and anti-inflammatory agents can be applied to a stent . . . ."

[0346] By way of yet further illustration, and referring to U.S. Pat. No. 5,605,696 (the entire disclosure of which is hereby incororporated by reference into this specification), the precursor may be a "selected therapeutic drug" that may be, e.g., " . . . anticoagulant antiplatelet or antithrombin agents such as heparin, D-phe-pro-arg-chloromethylketone (synthetic antithrombin), dipyridamole, hirudin, recombinant hirudin, thrombin inhibitor (available from Biogen), or c7E3 (an antiplatelet drug from Centocore); cytostatic or antiproliferative agents such as angiopeptin (a somatostatin analogue from Ibsen), angiotensin converting enzyme inhibitors such as Captopril (available from Squibb), Cilazapril (available from Hoffman-LaRoche), or Lisinopril (available from Merk); calcium channel blockers (such as Nifedipine), colchicine, fibroblast growth factor (FGF) antagonists, fish oil (omega 3-fatty acid), low molecular weight heparin (available from Wyeth, and Glycomed), histamine antagonists, Lovastatin (an inhibitor of HMG-CoA reductase, a cholesterol lowering drug from Merk), methotrexate, monoclonal antibodies (such as to PDGF receptors), nitroprusside, phosphodiesterase inhibitors, prostacyclin and prostacyclin analogues, prostaglandin inhibitor (available from Glaxo), Seramin (a PDGF antagonist), serotonin blockers, steroids, thioprotease inhibitors, and triazolopyrimidine (a PDGF antagonist). Other therapeutic drugs which may be appropriate include alphainterferon and genetically engineered epithelial cells, for example."

[0347] By way of yet further illustration, and referring to U.S. Pat. No. 5,700,286 (the entire disclosure of which is hereby incorporated by reference into this specification), precursor material may be a therapeutic agent or drug " . . . including, but not limited to, antiplatelets, antithrombins, cytostatic and antiproliferative agents, for example, to reduce or prevent restenosis in the vessel being treated. The therapeutic agent or drug is preferably selected from the group of therapeutic agents or drugs consisting of sodium heparin, low molecular weight heparin, hirudin, argatroban, forskolin, vapiprost, prostacyclin and prostacyclin analogues, dextran, D-phe-pro-arg-chloromethylketone, dipyridamole, glycoprotein IIb/IIIa platelet membrane receptor antibody, recombinant hirudin, thrombin inhibitor, angiopeptin, angiotensin converting enzyme inhibitors, (such as Captopril, available from Squibb; Cilazapril, available for Hoffman-La Roche; or Lisinopril, available from Merck) calcium channel blockers, colchicine, fibroblast growth factor antagonists, fish oil, omega 3-fatty acid, histamine antagonists, HMG-CoA reductase inhibitor, methotrexate, monoclonal antibodies, nitroprusside, phosphodiesterase inhibitors, prostaglandin inhibitor, seramin, serotonin blockers, steroids, thioprotease inhibitors, triazolopyrimidine and other PDGF antagonists, alpha-interferon and genetically engineered epithelial cells, and combinations thereof."

[0348] By way of yet further illustration, and referring to U.S. Pat. No. 5,900,433 (the entire disclosure of which is hereby incorporated by reference into this specification), the precursor material may be a congener of an endothelium-derived bioactive composition of matter. This congener is discussed in column 7 of the patent, wherein it is disclosed that "We have discovered that administration of a congener of an endothelium-derived bioactive agent, more particularly a nitrovasodilator, representatively the nitric oxide donor agent sodium nitroprusside, to an extravascular treatment site, at a therapeutically effective dosage rate, is effective for abolishing CFR's while reducing or avoiding systemic effects such as supression of platelet function and bleeding . . . congeners of an endothelium-derived bioactive agent include prostacyclin, prostaglandin E1, and a nitrovasodilator agent. Nitrovasodilater agents include nitric oxide and nitric oxide donor agents, including L-arginine, sodium nitroprusside and nitroglycycerine."

[0349] By way of yet further illustration, the precursor material may be heparin. As is disclosed in U.S. Pat. No. 6,120,536 (the entire disclosure of which is hereby incorporated by reference into this specification), "While heparin is preferred as the incorporated active material, agents possibly suitable for incorporation include antithrobotics, anticoagulants, antibiotics, antiplatelet agents, thorombolytics, antiproliferatives, steroidal and non-steroidal antinflammatories, agents that inhibit hyperplasia and in particular restenosis, smooth muscle cell inhibitors, growth factors, growth factor inhibitors, cell adhesion inhibitors, cell adhesion promoters and drugs that may enhance the formation of healthy neointimal tissue, including endothelial cell regeneration."

[0350] By way of yet further illustration, and referring to U.S. Pat. No. 6,624,138 (the entire disclosure of which is hereby incorporated by reference into this specification), the precursor material may be one or more of the drugs described in this patent. Thus, and referring to columns 9 et seq. of such patent, "Straub et al. in U.S. Pat. No. 6,395,300 discloses a wide variety of drugs that are useful in the methods and compositions described herein, entire contents of which, including a variety of drugs, are incorporated herein by reference. Drugs contemplated for use in the compositions described in U.S. Pat. No. 6,395,300 and herein disclosed include the following categories and examples of drugs and alternative forms of these drugs such as alternative salt forms, free acid forms, free base forms, and hydrates: analgesics/antipyretics. (e.g., aspirin, acetaminophen, ibuprofen, naproxen sodium, buprenorphine, propoxyphene hydrochloride, propoxyphene napsylate, meperidine hydrochloride, hydromorphone hydrochloide, morphine, oxycodone, codeine, dihydrocodeine bitartrate, pentazocine, hydrocodone bitartrate, levorphanol, diflunisal, trolamine salicylate, nalbuphine hydrochloride, mefenamic acid, butorphanol, choline salicylate, butalbital, phenyltoloxamine citrate, diphenhydramine citrate, methotrimeprazine, cinnamedrine hydrochloride, and meprobamate); antiasthamatics (e.g., ketotifen and traxanox); antibiotics (e.g., neomycin, streptomycin, chloramphenicol, cephalosporin, ampicillin, penicillin, tetracycline, and ciprofloxacin); antidepressants (e.g., nefopam, oxypertine, doxepin, amoxapine, trazodone, amitriptyline, maprotiline, phenelzine, desipramine, nortriptyline, tranylcypromine, fluoxetine, doxepin, imipramine, imipramine pamoate, isocarboxazid, trimipramine, and protriptyline); antidiabetics (e.g., biguanides and sulfonylurea derivatives); antifungal agents (e.g., griseofulvin, ketoconazole, itraconizole, amphotericin B, nystatin, and candicidin); antihypertensive agents (e.g., propanolol, propafenone, oxyprenolol, nifedipine, reserpine, trimethaphan, phenoxybenzamine, pargyline hydrochloride, deserpidine, diazoxide, guanethidine monosulfate, minoxidil, rescinnamine, sodium nitroprusside, rauwolfia serpentina, alseroxylon, and phentolamine); anti-inflammatories (e.g., (non-steroidal) indomethacin, ketoprofen, flurbiprofen, naproxen, ibuprofen, ramifenazone, piroxicam, (steroidal) cortisone, dexamethasone, fluazacort, celecoxib, rofecoxib, hydrocortisone, prednisolone, and prednisone); antineoplastics (e.g., cyclophosphamide, actinomycin, bleomycin, daunorubicin, doxorubicin, epirubicin, mitomycin, methotrexate, fluorouracil, carboplatin, carmustine (BCNU), methyl-CCNU, cisplatin, etoposide, camptothecin and derivatives thereof, phenesterine, paclitaxel and derivatives thereof, docetaxel and derivatives thereof, vinblastine, vincristine, tamoxifen, and piposulfan); antianxiety agents (e.g., lorazepam, buspirone, prazepam, chlordiazepoxide, oxazepam, clorazepate dipotassium, diazepam, hydroxyzine pamoate, hydroxyzine hydrochloride, alprazolam, droperidol, halazepam, chlormezanone, and dantrolene); immunosuppressive agents (e.g., cyclosporine, azathioprine, mizoribine, and FK506 (tacrolimus)); antimigraine agents (e.g., ergotamine, propanolol, isometheptene mucate, and dichloralphenazone); sedatives/hypnotics (e.g., barbiturates such as pentobarbital, pentobarbital, and secobarbital; and benzodiazapines such as flurazepam hydrochloride, triazolam, and midazolam); antianginal agents (e.g., beta-adrenergic blockers; calcium channel blockers such as nifedipine, and diltiazem; and nitrates such as nitroglycerin, isosorbide dinitrate, pentearythritol tetranitrate, and erythrityl tetranitrate); antipsychotic agents (e.g., haloperidol, loxapine succinate, loxapine hydrochloride, thioridazine, thioridazine hydrochloride, thiothixene, fluphenazine, fluphenazine decanoate, fluphenazine enanthate, trifluoperazine, chlorpromazine, perphenazine, lithium citrate, and prochlorperazine); antimanic agents (e.g., lithium carbonate); antiarrhythmics (e.g., bretylium tosylate, esmolol, verapamil, amiodarone, encainide, digoxin, digitoxin, mexiletine, disopyramide phosphate, procainamide, quinidine sulfate, quinidine gluconate, quinidine polygalacturonate, flecainide acetate, tocainide, and lidocaine); antiarthritic agents (e.g., phenylbutazone, sulindac, penicillanine, salsalate, piroxicam, azathioprine, indomethacin, meclofenamate, gold sodium thiomalate, ketoprofen, auranofin, aurothioglucose, and tolmetin sodium); antigout agents (e.g., colchicine, and allopurinol); anticoagulants (e.g., heparin, heparin sodium, and warfarin sodium); thrombolytic agents (e.g., urokinase, streptokinase, and alteplase); antifibrinolytic agents (e.g., aminocaproic acid); hemorheologic agents (e.g., pentoxifylline); antiplatelet agents (e.g., aspirin); anticonvulsants (e.g., valproic acid, divalproex sodium, phenytoin, phenytoin sodium, clonazepam, primidone, phenobarbitol, carbamazepine, amobarbital sodium, methsuximide, metharbital, mephobarbital, mephenytoin, phensuximide, paramethadione, ethotoin, phenacemide, secobarbitol sodium, clorazepate dipotassium, and trimethadione); antiparkinson agents (e.g., ethosuximide); antihistamines/antipruritics (e.g., hydroxyzine, diphenhydramine, chlorpheniramine, brompheniramine maleate, cyproheptadine hydrochloride, terfenadine, clemastine fumarate, triprolidine, carbinoxamine, diphenylpyraline, phenindamine, azatadine, tripelennamine, dexchlorphenirarnine maleate, methdilazine,; agents useful for calcium regulation (e.g., calcitonin, and parathyroid hormone); antibacterial agents (e.g., amikacin sulfate, aztreonam, chloramphenicol, chloramphenicol palirtate, ciprofloxacin, clindamycin, clindamycin palmitate, clindamycin phosphate, metronidazole, metronidazole hydrochloride, gentamicin sulfate, lincomycin hydrochloride, tobramycin sulfate, vancomycin hydrochloride, polymyxin B sulfate, colistimethate sodium, and colistin sulfate); antiviral agents (e.g., interferon alpha, beta or gamma, zidovudine, amantadine hydrochloride, ribavirin, and acyclovir); antimicrobials (e.g., cephalosporins such as cefazolin sodium, cephradine, cefaclor, cephapirin sodium, ceftizoxime sodium, cefoperazone sodium, cefotetan disodium, cefuroxime e azotil, cefotaxime sodium, cefadroxil monohydrate, cephalexin, cephalothin sodium, cephalexin hydrochloride monohydrate, cefamandole nafate, cefoxitin sodium, cefonicid sodium, ceforanide, ceftriaxone sodium, ceftazidime, cefadroxil, cephradine, and cefuroxime sodium; penicillins such as ampicillin, amoxicillin, penicillin G benzathine, cyclacillin, ampicillin sodium, penicillin G potassium, penicillin V potassium, piperacillin sodium, oxacillin sodium, bacampicillin hydrochloride, cloxacillin sodium, ticarcillin disodium, azlocillin sodium, carbenicillin indanyl sodium, penicillin G procaine, methicillin sodium, and nafcillin sodium; erythromycins such as erythromycin ethylsuccinate, erythromycin, erythromycin estolate, erythromycin lactobionate, erythromycin stearate, and erythromycin ethylsuccinate; and tetracyclines such as tetracycline hydrochloride, doxycycline hyclate, and minocycline hydrochloride, azithromycin, clarithromycin); anti-infectives (e.g., GM-CSF); bronchodilators (e.g., sympathomimetics such as epinephrine hydrochloride, metaproterenol sulfate, terbutaline sulfate, isoetharine, isoetharine mesylate, isoetharine hydrochloride, albuterol sulfate, albuterol, bitolterolmesylate, isoproterenol hydrochloride, terbutaline sulfate, epinephrine bitartrate, metaproterenol sulfate, epinephrine, and epinephrine bitartrate; anticholinergic agents such as ipratropium bromide; xanthines such as aminophylline, dyphylline, metaproterenol sulfate, and aminophylline; mast cell stabilizers such as cromolyn sodium; inhalant corticosteroids such as beclomethasone dipropionate (BDP), and beclomethasone dipropionate monohydrate; salbutamol; ipratropium bromide; budesonide; ketotifen; salmeterol; xinafoate; terbutaline sulfate; triamcinolone; theophylline; nedocromil sodium; metaproterenol sulfate; albuterol; flunisolide; fluticasone proprionate; steroidal compounds and hormones (e.g., androgens such as danazol, testosterone cypionate, fluoxymesterone, ethyltestosterone, testosterone enathate, methyltestosterone, fluoxymesterone, and testosterone cypionate; estrogens such as estradiol, estropipate, and conjugated estrogens; progestins such as methoxyprogesterone acetate, and norethindrone acetate; corticosteroids such as triamcinolone, betamethasone, betamethasone sodium phosphate, dexamethasone, dexamethasone sodium phosphate, dexamethasone acetate, prednisone, methylprednisolone acetate suspension, triamcinolone acetonide, methylprednisolone, prednisolone sodium phosphate, methylprednisolone sodium succinate, hydrocortisone sodium succinate, triamcinolone hexacetonide, hydrocortisone, hydrocortisone cypionate, prednisolone, fludrocortisone acetate, paramethasone acetate, prednisolone tebutate, prednisolone acetate, prednisolone sodium phosphate, and hydrocortisone sodium succinate; and thyroid hormones such as levothyroxine sodium); hypoglycemic agents (e.g., human insulin, purified beef insulin, purified pork insulin, glyburide, chlorpropamide, glipizide, tolbutarnide, and tolazamide); hypolipidemic agents (e.g., clofibrate, dextrothyroxine sodium, probucol, pravastitin, atorvastatin, lovastatin, and niacin); proteins (e.g., DNase, alginase, superoxide dismutase, and lipase); nucleic acids (e.g., sense or anti-sense nucleic acids encoding any therapeutically useful protein, including any of the proteins described herein); agents useful for erythropoiesis stimulation (e.g., erythropoietin); antiulcer/antireflux agents (e.g., famotidine, cimetidine, and ranitidine hydrochloride); antinauseants/antiemetics (e.g., meclizine hydrochloride, nabilone, prochlorperazine, dimenhydrinate, promethazine hydrochloride, thiethylperazine, and scopolamine); as well as other drugs useful in the compositions and methods described herein include mitotane, halonitrosoureas, anthrocyclines, ellipticine, ceftriaxone, ketoconazole, ceftazidime, oxaprozin, albuterol, valacyclovir, urofollitropin, famciclovir, flutamide, enalapril, mefformin, itraconazole, buspirone, gabapentin, fosinopril, tramadol, acarbose, lorazepan, follitropin, glipizide, omeprazole, fluoxetine, lisinopril, tramsdol, levofloxacin, zafirlukast, interferon, growth hormone, interleukin, erythropoietin, granulocyte stimulating factor, nizatidine, bupropion, perindopril, erbumine, adenosine, alendronate, alprostadil, benazepril, betaxolol, bleomycin sulfate, dexfenfluramine, diltiazem, fentanyl, flecainid, gemcitabine, glatiramer acetate, granisetron, lamivudine, mangafodipir trisodium, mesalamine, metoprolol fumarate, metronidazole, miglitol, moexipril, monteleukast, octreotide acetate, olopatadine, paricalcitol, somatropin, sumatriptan succinate, tacrine, verapamil, nabumetone, trovafloxacin, dolasetron, zidovudine, finasteride, tobramycin, isradipine, tolcapone, enoxaparin, fluconazole, lansoprazole, terbinafine, pamidronate, didanosine, diclofenac, cisapride, venlafaxine, troglitazone, fluvastatin, losartan, imiglucerase, donepezil, olanzapine, valsartan, fexofenadine, calcitonin, and ipratropium bromide. These drugs are generally considered to be water soluble." Any of these water-soluble drugs may be used as precursors in the process of this invention to make a composition with the desired magnetic properties.

[0351] As is also disclosed in U.S. Pat. No. 6,624,138, "Preferred drugs useful in the present invention may include albuterol, adapalene, doxazosin mesylate, mometasone furoate, ursodiol, amphotericin, enalapril maleate, felodipine, nefazodone hydrochloride, valrubicin, albendazole, conjugated estrogens, medroxyprogesterone acetate, nicardipine hydrochloride, zolpidem tartrate, amlodipine besylate, ethinyl estradiol, omeprazole, rubitecan, amlodipine besylate/benazepril hydrochloride, etodolac, paroxetine hydrochloride, paclitaxel, atovaquone, felodipine, podofilox, paricalcitol, betamethasone dipropionate, fentanyl, pramipexole dihydrochloride, Vitamin D3 and related analogues, finasteride, quetiapine fumarate, alprostadil, candesartan, cilexetil, fluconazole, ritonavir, busulfan, carbamazepine, flumazenil, risperidone, carbemazepine, carbidopa, levodopa, ganciclovir, saquinavir, amprenavir, carboplatin, glyburide, sertraline hydrochloride, rofecoxib carvedilol, halobetasolproprionate, sildenafil citrate, celecoxib, chlorthalidone, imiquimod, simvastatin, citalopram, ciprofloxacin, irinotecan hydrochloride, sparfloxacin, efavirenz, cisapride monohydrate, lansoprazole, tamsulosin hydrochloride, mofafinil, clarithromycin, letrozole, terbinafine hydrochloride, rosiglitazone maleate, diclofenac sodium, lomefloxacin hydrochloride, tirofiban hydrochloride, telmisartan, diazapam, loratadine, toremifene citrate, thalidomide, dinoprostone, mefloquine hydrochloride, trandolapril, docetaxel, mitoxantrone hydrochloride, tretinoin, etodolac, triamcinolone acetate, estradiol, ursodiol, nelfinavir mesylate, indinavir, beclomethasone dipropionate, oxaprozin, flutamide, famotidine, nifedipine, prednisone, cefuroxime, lorazepam, digoxin, lovastatin, griseofulvin, naproxen, ibuprofen, isotretinoin, tamoxifen citrate, nimodipine, amiodarone, and alprazolam. Specific non-limiting examples of some drugs that fall under the above categories include paclitaxel, docetaxel and derivatives, epothilones, nitric oxide release agents, heparin, aspirin, coumadin, PPACK, hirudin, polypeptide from angiostatin and endostatin, methotrexate, 5-fluorouracil, estradiol, P-selectin Glycoprotein ligand-1 chimera, abciximab, exochelin, eleutherobin and sarcodictyin, fludarabine, sirolimus, tranilast, VEGF, transforming growth factor (TGF)-beta, Insulin-like growth factor (IGF), platelet derived growth factor (PDGF), fibroblast growth factor (FGF), RGD peptide, beta or gamma ray emitter (radioactive) agents, and dexamethasone, tacrolimus, actinomycin-D, batimastat etc." These drugs also may be used in the process of this invention to make magnetic compositons.

ANOTHER PREFERRED COMPOUND OF THE INVENTION

[0352] In another embodiment of this invention, there is provided a compound that, in spite of having a molecular weight in excess of 550, still has a water solubility in excess of about 10 micrograms per milliliter. In particular, there is provided a compound with a molecular weight of at least about 550, a water solubility of at least about 10 micrograms per milliliter, a pKa dissociation constant of from about 1 to about 15, and a partition coefficient of from about 1.0 to about 50.

[0353] The compound of this embodiment of the invention has a molecular weight of at least about 550. In one embodiment, this compound has a molecular weight of at least about 700.

[0354] The water solubility of this compound is at least about 1 micrograms per milliliter and, more preferably, at least about 10 micrograms per milliliter. In one embodiment, such compound has a water solubility of at least about 100 micrograms per milliliter. In yet another embodiment, such compound has a water solubility of at least about 1,000 micrograms per milliliter.

[0355] The compound of this embodiment of the invention has a pKa dissociation constant of from about 1 to about 15. As used herein, the term "pKa dissociation constant" is equal to--log K.sub.a, wherein K.sub.a is equal to (H.sub.3 O.sup.+][A.sup.-]/[HA], wherein the square brackets ([ ]) indicate concentration, and wherein A is the counterion. Reference may be had, e.g., to pages 327-328 of Maitland Jones, Jr.'s "Organic Chemistry" (W. M. Norton & Company, New York, N.Y., 1997). Reference may also be had, e.g., to U.S. Pat. Nos. 5,036,164; 5,025,063; 5,767,066; 5,155,162; 5,132,000; and 5,079,134. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification

[0356] As is known to those skilled in the art, and as is disclosed at pages 39 et seq. of Stephen H. Curry et al.'s "Manual of Laboratory Phamaconkinetics" (John Wiley & Sons, New York, N.Y., 1983), "Many drugs are weak acids and/or bases. The degree of ionization will influence the absorption, distribution, and excretion in vivo, the solubility at a given pH, the distribution of the drug between aqueous and organic pahses the choice of pH in liquid chromatographic separations, etc. . . . . From the above it follows that the pH at which the compound is 50 percent ionized is equal to the pK.sub.a To determine a value of pK.sub.a the relative concentrations of ionized and non-ionized forms msut be known at a particular pH. Several methods are available, including potentiometric titration, conductimetry, solubility, and spectrometery . . . ."

[0357] The compound of this embodiment of the invention preferably has a partition coefficient of from about 1.0 to about 50. This partition coefficient is also dicussed at pages 41 et seq. of the aforementioned Curry book, wherein it is disclosed that: "When a solute is distributed between two immiscible phases, 1 and 2, the ratio of the activities of the solute in the phases is constant. If the solutions are dilute and ideal behavior is assumed, then the ratio of the concentration of the solute will be constant . . . . The constant is known as the partition (or distribution) coefficient . . . . The convention with regard to which phase is classed as 1 and which is as 2 is not entirely clear. Usually, partition coefficients are defined as the concentration in the organic phase divided by the concentration in the aqueous phase."

[0358] It is preferred to measure the partition coefficient between water and octane. Means for measuring the partition coefficient are well known to-those skilled in the art and are described, e.g., in the patent literature. Reference may be had, e.g., to U.S. Pat. Nos. 6,660,288; 6,645,479; 6,585,953; 6,583,136; 6,500,995; 6,475,961; 6.369.001; 6,362,158; 6,315,907; 6,310,013; 6,271,665; 6,218,378; 6,203,817; 6,156,826; 6,124,086; 6,071,409; 6,045,835; 6,042,792; 5,874,481; 5,763,146; 5,555,747; 5,252,320 (complexes having a partition coefficient above 300); U.S. Pat. Nos. 5,254,342; 5,252,320; 5,164,189; 5,071,769; 5,041,523; -5,013,556; 5,011,982; 5,011,967; 4,986,917; 4,980,453; 4,957,862; 4,940,654; 4,886,656; 4,859,584; 4,762,701; 4,746,745; 4,743,550 (method for improving the partition coefficient in enzyme containing systems having at least two phases), U.S. Pat. Nos. 4,736,016; 4,721,730; 4,699,924; 4,619,939; 4,420,473; 4,371,540; 4,363,793; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

[0359] In one embodiment, the compound of this invention has a tumor uptake of at least about 10 percent and, more preferably, at least about 20 percent. In one embodiment, the tumor uptake is at least about 30 percent. In yet another embodiment, the tumor uptake is at least about 50 percent. In yet another embodiment, the tumor uptake is at least about 70 percent.

[0360] Tumor uptake is the extent to which the compound is selectively taken up by tumors from blood. It may be determined by dissolving 1 milligram of the compound to be tested in 1 milliliter of "Cremophor EL," a 1:1 (volume/volume) mixture of anhydrous ethanol and polyethoxylated castor oil. For a discussion of such "Cremophor EL," reference may be had, e.g., to U.S. Pat. No. 5,591,715 (methods and compositions for reducing multidrug resistance), U.S. Pat. No. 5,686,488 (polyethoxylated castor oil products as anti-inflammatory agents), U.S. Pat. No. 5,776,891 (compositions for reducing multidrug resistance), and the like. The entire disclosure4 of each of these United States patents is hereby incorporated by reference into this specification.

[0361] The mixture of the compound to be tested and "Cremophor EL" is injected ito the blood supply (artery) of a laboratory rat, near the tumor. Thirty seconds later the rate is sacrificed, the tumor is removed, and it and the blood are analyzed for the presence of the compound. Both the arterial blood and the venous drainage beyond the tumor are analyzed. The percent tumor uptake is equal to ([C.sub.a-C.sub.v]/C.sub.a).times.100, wherein C.sub.a is the concentration of the compound in the arterial blood, and C.sub.v is the concentration of the compound in the venous blood.

[0362] Other conventional means may be used to determine the tumor uptake. Reference may be had, e.g., to U.S. Pat. Nos. 4,448,762; 5,077,034; 5,094,835; 5,135,717; 5,166,944; 5,284,831; 5,391,547; 5,399,338; 5,474,772; 5,516,940; 5,578,287; 5,595,738; 5,601,800; 5,608,060; 5,616,690; 5,624,798; 5,624,896; 5,683,873; 5,688,501; 5,753,262; 5,762,909; 5,783,169; 5,810,888; 5,811,073; 5,820,873; 5,847,121; 5,869,248; 5,877,162; 5,891,689; 5,902,604; 5,911,969; 5,914,312; 5,955,605; 5,965,598; 5,976,535; 5,976,874;6,008,319; 6,022,522; 6,022,966; 6,025,165; 6,027,725; 6,057,153; 6,074,626; 6,103,889; 6,121,424; 6,165,441; 6,171,577; 6,172,045; 6,197,333; 6,217,869; 6,217,886; 6,235,264; 6,242,477; 6,331,287; 6,348,214; 6,358,490; 6,403,096; 6,426,400; 6,436,708; 6,441,158; 6,458,336; 6,498,181; 6,515,110; 6,537,521; 6,610,478; 6,617,135; 6,620,805; 6,624,187; 6,723,318; 6,734,171; 6,685,915; and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

GUIDED DELIVERY OF THE COMPOUNDS OF THIS INVENTION

[0363] In one preferred embodiment, the magnetic properties of the anti-mitotic compound of this invention are used in order to preferentially deliver such compound to a specified site. In another embodiment, the magnetic properties of the compounds and compositions of this invention which are not necessarily anti-mitotic but have the desired magnetic properties also may be used to deliver such compounds and/or compositions to a desired site.

[0364] Thus, by way of illustration, one may guide delivery of the compound of this invention with conventional magnetic focusing means. In one aspect of this embodiment, a magnetic field of a specified strength is focused onto a desired therapeutic site, such as a tumor to be treated, whereby the compound is selectively drawn to the therapeutic site and binds with tubulin moleuces at the site. In one embodiment, the focused magnetic field has a field strength of at least about 6 Tesla in order to cause microtubules to move linearly. The magnetic field may, e.g., be focused for a period of at least about 30 minutes following the administration of the compound of this invention.

[0365] One may use any of the conventional magnetic field generators known to those skilled in the art to produce such a magnetic field. Thus, e.g., one may use one or more of the magnetic field generators disclosed in U.S. Pat. Nos. 6,503,364; 6,377,149 (magnetic field generator for magnetron plasma generation); U.S. Pat. No. 6,353,375 (magnetostatic wave device); U.S. Pat. No. 6,340,888 (magnetic field generator for MRI); U.S. Pat. Nos. 6,336,989; 6,335,617 (device for calibrating a magnetic field generator); U.S. Pat. Nos. 6,313,632; 6,297,634; 6,275,128; 6,246,066 (magnetic field generator and charged particle beam irradiator); U.S. Pat. No. 6,114,929 (magnetostatic wave device); U.S. Pat. No. 6,099,459 (magnetic field generating device and method of generating and applying a magnetic field); U.S. Pat. Nos. 5,795,212; 6,106,380 (deterministic magnetorheological finishing); U.S. Pat. No. 5,839,944 (apparatus for deterministic magnetorheological finishing); U.S. Pat. No. 5,971,835 (system for abrasive jet shaping and polishing of a surface using a magnetorheological fluid); U.S. Pat. Nos. 5,951,369; 6,506,102 (system for magnetorheological finishing of substrates); U.S. Pat. Nos. 6,267,651; 6,309,285 (magnetic wiper); U.S. Pat. Nos. 5,929,732 and 6,488,615 (which describe devices and methods for creating a high intensity magnetic field for magnetically guiding a anti-mitotic compoundto a predetermined site within a biological organism), and the like. The entire disclosure of each of these United States patents is hereby incorporated by reference into this specification.

The Use of Externally Applied Energy to Affect an Implanted Medical Device

[0366] The prior art discloses many devices in which an externally applied electromagnetic field (i.e., a field originating outside of a biological organism, such as a human body) is generated in order to influence one or more implantable devices disposed within the biological organism; these may be used in conjunction with anti-mitotic compound of this invention. Some of these devices are described below.

[0367] U.S. Pat. No. 3,337,776 describes a device for producing controllable low frequency magnetic fields; the entire disclosure of this patent is hereby incorporated by reference into this specification. Thus, e.g., claim 1 of this patent describes a biomedical apparatus for the treatment of a subject with controllable low frequency magnetic fields, comprising solenoid means for creating the magnetic field. These low-frequency magnetic fields may be used to affect the anti-mitotic compounds of this invention, and/or tubulin and/or microtubules and/or other moieties.

[0368] U.S. Pat. No. 3,890,953 also discloses an apparatus for promoting the growth of bone and other body tissues by the application of a low frequency alternating magnetic field; the entire disclosure of this United States patent is hereby incorporated by reference into this specification. This patent claims "In an electrical apparatus for promoting the growth of bone and other body tissues by the application thereto of a low frequency alternating magnetic field, such apparatus having current generating means and field applicator means, the improvement wherein the applicator means comprises a flat solenoid coil having an axis about which the coil is wound and composed of a plurality of parallel and flexible windings, each said winding having two adjacent elongate portions and two 180.degree. coil bends joining said elongate portions together, said coil being flexible in the coil plane in the region of said elongate portion for being bent into a U-shape, said coil being bent into such U-shape about an axis parallel to the coil axis and adapted for connection to a source of low frequency alternating current." These low-frequency magnetic fields may be used to affect the anti-mitotic compounds of this invention, and/or tubulin and/or microtubules and/or other moieties.

[0369] The device of U.S. Pat. No. 3,890,953 is described, in part, at lines 52 et seq. of column 2, wherein it is disclosed that: "The apparatus shown diagrammatically in FIG. 1 comprises a AC generator 10, which supplies low frequency AC at the output terminals 12. The frequency of the AC lies below 150 Hz, for instance between 1 and 50 or 65 Hz. It has been found particularly favorable to use a frequency range between 5 or 10 and 30 Hz, for example 25 Hz. The half cycles of the alternating current should have comparatively gently sloping leading and trailing flanks (rise and fall times of the half cycles being for example in the order of magnitude of a quarter to an eighth of the length of a cycle); the AC can thus be a sinusoidal current with a low non-linear distortion, for example less than 20 percent, or preferably less than 10 percent, or a triangular wave current."

[0370] U.S. Pat. No. 4,095,588 discloses a "vascular cleansing device" adapted to " . . . effect motion of the red corpuscles in the blood stream of a vascular system . . . whereby these red cells may cleanse the vascular system by scrubbing the walls thereof . . . ;" the entire disclosure of this United States patent is hereby incorporated by reference into this specification. This patent claims (in claim 3) "A means to propel a red corpuscle in a vibratory and rotary fashion, said means comprising an electronic circuit and magnetic means including: a source of electrical energy; a variable oscillator connected to said source; a binary counter means connected to said oscillator to produce sequential outputs; a plurality of deflection amplifier means connected to be operable by the outputs of said binary counter means in a sequential manner, said amplifier means thereby controlling electrical energy from said source; a plurality of separate coils connected in separate pairs about an axis in series between said deflection amplifier means and said source so as to be sequentially operated in creating an electromagnetic field from one coil to the other and back again and thence to adjacent separate coils for rotation of the electromagnetic field from one pair of coils to another; and a table within the space encircled by said plurality of coils, said table being located so as to place a person along the axis such that the red corpuscles of the person's vascular system are within the electromagnetic field between the coils creating same." The energy used to affect such red blood corpuscles may also be used affect the anti-mitotic compounds of this invention, and/or tubulin and/or microtubules and/or other moieties.

[0371] U.S. Pat. No. 4,323,075 discloses an implantable defibrillator with a rechargeable power supply; the entire disclosure of this patent is hereby incorporated by reference into this specification. Claim 1 of this patent describes "A fully implantable power supply for use in a fully implantable defibrillator having an implantable housing, a fibrillation detector for detecting fibrillation of the heart of a recipient, an energy storage and discharge device for storing and releasing defibrillation energy into the heart of the recipient and an inverter for charging the energy storage and discharge device in response to detection of fibrillation by the fibrillation detector, the inverter requiring a first level of power to be operational and the fibrillation detector requiring a second level of power different from said first level of power to be operational, said power supply comprising: implantable battery means positioned within said implantable housing, said battery means including a plurality of batteries arranged in series, each of said batteries having a pair of output terminals, each of said batteries producing a distinctly multilevel voltage across its pair of output terminals, said voltage being at a first level when the battery is fully charged and dropping to a second level at some point during the discharge of the battery; and implantable circuit means positioned within said implantable housing, said circuit means for creating a first conductive path betwen said serially-connected batteries and said fibrillation detector to provide said fibrillation detector with said second level of power, and for creating a second conductive path between said inverter and said battery means by placing only the batteries operating at said first level voltage in said second conductive path, and excluding the remaining batteries from said second conductive path to provide said inverter with said first level of power." The power supply of this patent may be used to power, e.g., one or more magnetic focusing devices.

[0372] U.S. Pat. No. 4,340,038 discloses an implanted medical system comprised of magnetic field pick-up means for converting magnetic energy to electrical energy; the entire disclosure of this patentis hereby incorporated by reference into this specification. One may use the electrical energy produced by such pick-up means to affect the anti-mitotic compounds of this invention, and/or tubulin and/or microtubules and/or other moieties. Such energy may also be used to power an implanted magnetic focusing device.

[0373] In column 1 of U.S. Pat. No. 4,340,038, at lines 12 et seq., it is disclosed that "Many types of implantable devices incorporate a self-contained transducer for converting magnetic energy from an externally-located magnetic field generator to energy usable by the implanted device. In such a system having an implanted device and an externally-located magnetic field generator for powering the device, sizing and design of the power transfer system is important. In order to properly design the power transfer system while at the same time avoiding overdesign, the distance from the implanted device to the magnetic field generator must be known. However for some types of implanted devices the depth of the implanted device in a recipient's body is variable, and is not known until the time of implantation by a surgeon. One example of such a device is an intracranial pressure monitoring device (ICPM) wherein skull thickness varies considerably between recipients and the device must be located so that it protrudes slightly below the inner surface of the skull and contacts the dura, thereby resulting in a variable distance between the top of the implanted device containing a pick-up coil or transducer and the outer surface of the skull. One conventional technique for accommodating an unknown distance between the magnetic field generator and the implanted device includes increasing the transmission power of the external magnetic field generator. However this increased power can result in heating of the implanted device, the excess heat being potentially hazardous to the recipient. A further technique has been to increase the diameter of the pick-up coil in the implanted device. However, physical size constraints imposed on many implanted devices such as the ICPM are critical; and increasing the diameter of the pick-up coil is undesirable in that it increases the size of the orifice which must be formed in the recipient's skull. The concentrator of the present invention solves the above problems by concentrating magnetic lines of flux from the magnetic generator at the implanted pick-up coil, the concentrator being adapted to accommodate distance variations between the implanted device and the magnetic field generator.

[0374] Claim 1 of U.S. Pat. No. 4,340,038 describes "In a system including an implanted device having a magnetic field pick-up means for converting magnetic energy to electrical energy for energizing said implanted device, and an external magnetic field generator located so that magnetic lines of flux generated thereby intersect said pick-up means, a means for concentrating a portion of said magnetic lines of flux at said pick-up means comprising a metallic slug located between said generator and said pick-up means, thereby concentrating said magnetic lines of flux at said pick-up means." claim 5 of this patent further describes the pick-up means as comprising " . . . a magnetic pick-up coil and said slug is formed in the shape of a truncated cone and oriented so that a plane defined by the smaller of said cone end surfaces is adjacent to said substantially parallel to a plane defined by said magnetic pick-up coil." In one embodiment, such pick-up means may be located near the site to be treated (such as a tumor) and may be used to affect the tumor by, e.g., hyperthermia treatement.

[0375] U.S. Pat. No. 4,361,153 discloses an implantable telemetry system; the entire disclosure of such United States patent is hereby incorporated by reference into this specification. Such an implantable telemetry system, equipped with a multiplicity of sensors, may be used to report how the anti-mitotic compounds of this invention, and/or tubulin and/or microtubules and/or other moieties respond to applied electromagnetic fields.

[0376] As is disclosed at column 1 of U.S. Pat. No. 4,361,153 (see lines 9 et seq.), "Externally applied oscillating magnetic fields have been used before with implanted devices. Early inductive cardiac pacers employed externally generated electromagnetic energy directly as a power source. A coil inside the implant operated as a secondary transformer winding and was interconnected with the stimulating electrodes. More recently, implanted stimulators with rechargeable (e.g., nickel cadmium) batteries have used magnetic transmission to couple energy into a secondary winding in the implant to energize a recharging circuit having suitable rectifier circuitry. Miniature reed switches have been utilized before for implant communications. They appear to have been first used to allow the patient to convert from standby or demand mode to fixed rate pacing with an external magnet. Later, with the advent of programmable stimulators, reed switches were rapidly cycled by magnetic pulse transmission to operate pulse parameter selection circuitry inside the implant. Systems analogous to conventional two-way radio frequency (RF) and optical communication system have also been proposed. The increasing versatility of implanted stimulators demands more complex programming capabilities. While various systems for transmitting data into the implant have been proposed, there is a parallel need to develop compatible telemetry systems for signalling out of the implant. However, the austere energy budget constraints imposed by long life, battery operated implants rule out conventional transmitters and analogous systems

[0377] The solution provided by U.S. Pat. No. 4,361,153 is " . . . achieved by the use of a resonant impedance modulated transponder in the implant to modulate the phase of a relatively high energy reflected magnetic carrier imposed from outside of the body." In particular, and as is described by claim 1 of this patent, there is claimed "An apparatus for communicating variable information to an external device from an electronic stimulator implanted in a living human patient, comprising an external unit including means for transmitting a carrier signal, a hermetically sealed fully implantable enclosure adapted to be implanted at a fixed location in the patient's body, means within said enclosure for generating stimulator outputs, a transponder within said enclosure including tuned resonant circuit means for resonating at the frequency of said carrier signal so as to re-radiate a signal at the frequency of said carrier signal, and means for superimposing an information signal on the reflected signal by altering the resonance of said tuned circuit means in accordance with an information signal, said superimposing means including a variable impedance load connected across said tuned circuit and means for varying the impedance of said load in accordance with an information signal, said external unit further including pickup means for receiving the reflected signal from said transponder and means for recovering the information signal superimposed thereon, said receiving means including means reponsive to said reflected signal from said transponder for producing on associated analog output signal, and said recovering means including phase shift detector means responsive to said analog output signal for producing an output signal related to the relative phase angle thereof."

[0378] U.S. Pat. No. 4,408,607 discloses a rechargeable, implantable capacitive energy source; the entire disclosure of this patent is hereby incorporated into this specification by reference; and this source may be used to directly or indirectly supply energy to one or more of the anti-mitotic compounds of this invention, and/or tubulin and/or microtubules and/or other moieties. As is disclosed in column 1 of such patent (at lines 12 et seq.), "Medical science has advanced to the point where it is possible to implant directly within living bodies electrical devices necessary or advantageous to the welfare of individual patients. A problem with such devices is how to supply the electrical energy necessary for their continued operation. The devices are, of course, designed to require a minimum of electrical energy, so that extended operation from batteries may be possible. Lithium batteries and other primary, non-rechargeable cells may be used, but they are expensive and require replacement of surgical procedures. Nickel-cadmium and other rechargeable batteries are also available, but have limited charge-recharge characteristics, require long intervals for recharging, and release gas during the charging process."The solution to this problem is described, e.g., in claim 1 of the patent, which describes "An electric power supply for providing electrical energy to an electrically operated medical device comprising: capacitor means for accommodating an electric charge; first means providing a regulated source of unidirectional electrical energy; second means connecting said first means to said capacitor means for supplying charging current to said capacitor means at a first voltage which increases with charge in the capacitor means; third means deriving from said first means a comparison second voltage of constant magnitude; comparator means operative when said first voltage reaches a first value to reduce said first voltage to a second, lower value; and voltage regulator means connected to said capacitor means and medical device to limit the voltage supplied to the medical device."

[0379] U.S. Pat. No. 4,416,283 discloses an implantable shunted coil telemetry transponder employed as a magnetic pulse transducer for receiving externally transmitted data; the entire disclosure of this United States patent is hereby incorporated by reference into this specification. This transponder may be used in a manner similar to that of the aforementioned telemetry system.

[0380] In particular, a programming system for a biomedical implant is described in claim 1 of U.S. Pat. No. 4,416,283. Such claim 1 discloses "In a programming system for a biomedical implant of the type wherein an external programmer,produces a series of magnetic impulses which are received and transduced to form a corresponding electrical pulse input to programmable parameter data registers inside the implant, wherein the improvement comprises external programming pulse receiving and transducing circuitry in the implant including a tuned coil, means responsive to pairs of successive voltage spikes of opposite polarity magnetically induced across said tuned coil by said magnetic impulses for forming corresponding binary pulses duplicating said externally generated magnetic impulses giving rise to said spikes, and means for outputting said binary pulses to said data registers to accomplish programming of the implant."

[0381] U.S. Pat. No. 4,871,351 discloses an implantable pump infusion system; the entire disclosure of this United States patent is hereby incorporated by reference into this specification. These implantable pumps are discussed in column 1 of the patent, wherein it is disclosed that: "Certain human disorders, such as diabetes, require the injection into the body of prescribed amounts of medication at prescribed times or in response to particular conditions or events. Various kinds of infusion pumps have been propounded for infusing drugs or other chemicals or solutions into the body at continuous rates or measured dosages. Examples of such known infusion pumps and dispensing devices are found in U.S. Pat. Nos 3,731,861; 3,692,027; 3,923,060; 4,003,379; 3,951,147; 4,193,397; 4,221,219 and 4,258,711. Some of the known pumps are external and inject the drugs or other medication into the body via a catheter, but the preferred pumps are those which are fully implantable in the human body." One may use the implantable pumps of this patent to delivery the anti-mitotic compound of this invention to a specified site and, thereafter, to "finely focus" such delivery by means of magnetic focusing means.

[0382] U.S. Pat. No. 4,871,351 also discloses that: "Implantable pumps have been used in infusion systems such as those disclosed in U.S. Pat. Nos. 4,077,405; 4,282,872; 4,270,532; 4,360,019 and 4,373,527. Such infusion systems are of the open loop type. That is, the systems are pre-programmed to deliver a desired rate of infusion. The rate of infusion may be programmed to vary with time and the particular patient. A major disadvantage of such open loop systems is that they are not responsive to the current condition of the patient, i.e. they do not have feedback information. Thus, an infusion system of the open loop type may continue dispensing medication according to its pre-programmed rate or profile when, in fact, it may not be needed."

[0383] U.S. Pat. No. 4,871,351 also discloses that: "There are known closed loop infusion systems which are designed to control a particular condition of the body, e.g. the blood glucose concentration. Such systems use feedback control continuously, i.e. the patient's blood is withdrawn via an intravenous catheter and analysed continuously and a computer output signal is derived from the actual blood glucose concentration to drive a pump which infuses insulin at a rate corresponding to the signal. The known closed loop systems suffer from several disadvantages. First, since they monitor the blood glucose concentration continuously they are complex and relatively bulky systems external to the patient, and restrict the movement of the patient. Such systems are suitable only for hospital bedside applications for short periods of time and require highly trained operating staff. Further, some of the known closed loop systems do not allow for manually input overriding commands. Examples of closed loop systems are found in U.S. Pat. Nos. 4,055,175; 4,151,845 and 4,245,634."

[0384] U.S. Pat. No. 4,871,351 also discloses that "An implanted closed loop system with some degree of external control is disclosed in U.S. Pat. No. 4,146,029. In that system, a sensor (either implanted or external) is arranged on the body to sense some kind of physiological, chemical, electrical or other condition at a particular site and produced data which corresponds to the sensed condition at the sensed site. This data is fed directly to an implanted microprocessor controlled medication dispensing device. A predetermined amount of medication is dispensed in response to the sensed condition according to a pre-programmed algorithm in the microprocessor control unit. An extra-corporeal coding pulse transmitter is provided for selecting between different algorithms in the microprocessor control unit. The system of U.S. Pat. No. 4,146,029 is suitable for use in treating only certain ailments such as cardiac conditions. It is unsuitable as a blood glucose control system for example, since (i) it is not practicable to measure the blood glucose concentration continuously with an implanted sensor and (ii) the known system is incapable of dispensing discrete doses of insulin in response to certain events, such as meals and exercise. Furthermore, there are several disadvantages to internal sensors; namely, due to drift, lack of regular calibration and limited life, internal sensors do not have high long-term reliability. If an external sensor is used with the system of U.S. Pat. No. 4,146,029, the output of the sensor must be fed through the patient's skin to the implanted mechanism. There are inherent disadvantages to such a system, namely the high risk of infection. Since the algorithms which control the rate of infusion are programmed into the implanted unit, it is not possible to upgrade these algorithms without surgery. The extra-corporeal controller merely selects a particular one of several medication programs but cannot actually alter a program."

[0385] U.S. Pat. No. 4,871,351 also discloses that "It is an object of the present invention to overcome, or substantially ameliorate the above described disadvantages of the prior art by providing an implantable open loop medication infusion system with a feedback control option"

[0386] The solution to this problem is set forth in claim 1 of United States patent 4,871,351,which describes: "A medical infusion system intermittently switchable at selected times between an open loop system without feedback and a closed loop system with feedback, said system comprising an implantable unit including means for controllably dispensing medication into a body, an external controller, and an extra-corporeal sensor; wherein said implantable unit comprises an implantable transceiver means for communicating with a similar external transceiver means in said external controller to provide a telemetry link between said controller and said implantable unit, a first reservoir means for holding medication liquid, a liquid dispensing device, a pump connected between said reservoir means and said liquid dispensing device, and a first electronic control circuit means connected to said implantable transceiver means and to said pump to operate said pump; wherein said external controller comprises a second electronic control circuit means connected with said external transceiver means, a transducer means for reading said sensor, said transducer means having an output connected to said second electronic control circuit means, and a manually operable electric input device connected to said second electronic control circuit means; wherein said pump is operable by said first electronic control circuit means to pump said medication liquid from said first reservoir means to said liquid-dispensing deive at a first predetermined rate independent of the output of said extra-corporeal sensor, and wherein said input device or said transducer means include means which selectively operable at intermittent times to respectively convey commands or output of said transducer representing the reading of said sensor to said second control circuit to instruct said first control circuit via said telemetry link to modify the operation of said pump."

[0387] U.S. Pat. No. 4,941,461 describes an electrically actuated inflatable penile erecton device comprised of an implantable induction coil and an implantable pump; the entire disclosure of this United States patent is hereby incorporated by reference into this specification. The device of this patent is described, e.g., in claim 1 of the patent, which discloses "An apparatus for achieving a penile erection in a human male, comprising: at least one elastomer cylinder having a root chamber and a pendulous chamber, said elastomer cylinder adapted to be placed in the corpus carvenosum of the penis; an external magnetic field generator which can be placed over some section of the penis which generates an alternating magnetic field; an induction coil contained within said elastomer cylinder which produces an alternating electric current when in the proximity of said alternating magnetic filed which is produced by said external magnetic field generator; and a fluid pumping means located within said elastomer cylinder, said pumping means being operated by the electrical power generated in said induction coil to pump fluid from said root chamber to said pendulous chamber in order to stiffen said elastomer cylinder for causing the erect state of the penis."

[0388] U.S. Pat. No. 5,487,760 discloses an implantable signal transceiver disposed in an artificial heart valve; this transceiver may be used in the process of this invention in accordance with the aforementioned telemetry device; and the entire disclosure of this United States patent is hereby incorporated by reference into this specification. Claim 1 of this patent describes: "In combination, an artificial heart valve of the type having a tubular body member, defining a lumen and pivotally supporting at least one occluder, said body member having a sewing cuff covering an exterior surface of said body member; and an electronic sensor module disposed between said sewing cuff and said exterior surface, wherein said sensor module incorporates a sensor element for detecting movement of said at least one occluder between an open and a closed disposition relative to said lumen and wherein said sensor module further includes a signal transceiver coupled to said sensor element, and means for energizing said signal transceiver, and wherein said sensor module includes means for encapsulating said sensor element, signal transceiver and energizing means in a moisture-impervious container."

[0389] As will be apparent to those skilled in the art, the sensor/transceiver combination may advantageously be used in conjunction with the anti-mitotic compound of this invention, and/or microtubules.

[0390] U.S. Pat. No. 5,702,430 discloses an implantable power supply; the entire disclosure of such patent is hereby incorporated by reference into this specification. This implantable power supply may be used to supply power to either the compound of this invention, the treatment site, and/or one or more other devices from which a specified energy output is desired.

[0391] Claim 1 of U.S. Pat. No. 5,702,430 describes: "A surgically implantable power supply comprising battery means for providing a source of power, charging means for charging the battery means, enclosure means isolating the battery means from the human body, gas holding means within the enclosure means for holding gas generated by the battery means during charging, seal means in the enclosure means arranged to rapture when the internal gas pressure exceeds a certain value and inflatable gas container means outside the enclosure means to receive gas from within the enclosure means when the seal means has been ruptured."

[0392] Columns 1 through 5 of U.S. Pat. No. 5,702,430 presents an excellent discussion of "prior art" implantable pump assemblies that may be used, e.g., to deliver the anti-mitotic compound of this invention. As is disclosed in such portion of U.S. Pat. No. 5,702,430, "The most widely tested and commonly used implantable blood pumps employ variable forms of flexible sacks (also spelled sacs) or diaphragms which are squeezed and released in a cyclical manner to cause pulsatile ejection of blood. Such pumps are discussed in books or articles such as Hogness and Antwerp 1991, DeVries et al 1984, and Farrar et al 1988, and in U.S. Pat. No. 4,994,078 (Jarvik 1991), U.S. Pat. No. 4,704,120 (Slonina 1987), U.S. Pat. No. 4,936,758 (Coble 1990), and U.S. Pat. No. 4,969,864 (Schwarzmann et al 1990). Sack or diaphragm pumps are subject to fatigue failure of compliant elements and as such are mechanically and functionally quite different from the pump which is the subject of the present invention."

[0393] U.S. Pat. No. 5,702,430 also discloses that "An entirely different class of implantable blood pumps uses rotary pumping mechanisms. Most rotary pumps can be classified into two categories: centrifugal pumps and axial pumps. Centrifugal pumps, which include pumps marketed by Sarns (a subsidiary of the 3M Company) and Biomedicus (a subsidiary of Medtronic, Eden Prairie, Minn.), direct blood into a chamber, against a spinning interior wall (which is a smooth disk in the Medtronic pump). A flow channel is provided so that the centrifugal force exerted on the blood generates flow."

[0394] U.S. Pat. No. 5,702,430 also discloses that "By contrast, axial pumps provide blood flow along a cylindrical axis, which is in a straight (or nearly straight) line with the direction of the inflow and outflow. Depending on the pumping mechanism used inside an axial pump, this can in some cases reduce the shearing effects of the rapid acceleration and deceleration forces generated in centrifugal pumps. However, the mechanisms used by axial pumps can inflict other types of stress and damage on blood cells."

[0395] U.S. Pat. No. 5,702,430 also discloses that "Some types of axial rotary pumps use impeller blades mounted on a center axle, which is mounted inside a tubular conduit. As the blade assembly spins, it functions like a fan, or an outboard motor propeller. As used herein, "impeller" refers to angled vanes (also called blades) which are constrained inside a flow conduit; an impeller imparts force to a fluid that flows through the conduit which encloses the impeller. By contrast, "propeller" usually refers to non-enclosed devices, which typically are used to propel vehicles such as boats or airplanes."

[0396] "Another type of axial blood pump, called the "Haemopump" (sold by Nimbus) uses a screw-type impeller with a classic screw (also called an Archimedes screw; also called a helifoil, due to its helical shape and thin cross-section). Instead of using several relatively small vanes, the Haemopump screw-type impeller contains a single elongated helix, comparable to an auger used for drilling or digging holes. In screw-type axial pumps, the screw spins at very high speed (up to about 10,000 rpm). The entire Haemopump unit is usually less than a centimeter in diameter. The pump can be passed through a peripheral artery into the aorta, through the aortic valve, and into the left ventricle. It is powered by an external motor and drive unit."

[0397] U.S. Pat. No. 5,702,430 also discloses that "Centrifugal or axial pumps are commonly used in three situations: (1) for brief support during cardio-pulmonary operations, (2) for short-term support while awaiting recovery of the heart from surgery, or (3) as a bridge to keep a patient alive while awaiting heart transplantation. However, rotary pumps generally are not well tolerated for any prolonged period. Patients who must rely on these units for a substantial length-of time often suffer from strokes, renal (kidney) failure, and other organ dysfunction. This is due to the fact that rotary devices, which must operate at relatively high speeds, may impose unacceptably high levels of turbulent and laminar shear forces on blood cells. These forces can damage or lyse (break apart) red blood cells. A low blood count (anemia) may result, and the disgorged contents of lysed blood cells (which include large quantities of hemoglobin) can cause renal failure and lead to platelet activation that can cause embolisms and stroke."

[0398] "One of the most important problems in axial rotary pumps in the prior art involves the gaps that exist between the outer edges of the blades, and the walls of the flow conduit. These gaps are the site of severe turbulence and shear stresses, due to two factors. Since implantable axial pumps operate at very high speed, the outer edges of the blades move extremely fast and generate high levels of shear and turbulence. In addition, the gap between the blades and the wall is usually kept as small as possible to increase pumping efficiency and to reduce the number of cells that become entrained in the gap area. This can lead to high-speed compression of blood cells as they are caught in a narrow gap between the stationary interior wall of the conduit and the rapidly moving tips or edges of the blades."

[0399] U.S. Pat. No. 5,702,430 also discloses that "An important factor that needs to be considered in the design and use of implantable blood pumps is "residual cardiac function," which is present in the overwhelming majority of patients who would be candidates for mechanical circulatory assistance. The patient's heart is still present and still beating, even though, in patients who need mechanical pumping assistance, its output is not adequate for the patient's needs. In many patients, residual cardiac functioning often approaches the level of adequacy required to support the body, as evidenced by the fact that the patient is still alive when implantation of an artificial pump must be considered and decided. If cardiac function drops to a level of severe inadequacy, death quickly becomes imminent, and the need for immediate intervention to avert death becomes acute."

[0400] U.S. Pat. No. 5,702,430 also discloses that "Most conventional ventricular assist devices are designed to assume complete circulatory responsibilities for the ventricle they are "assisting. As such, there is no need, nor presumably any advantage, for the device to interact in harmony with the assisted ventricle. Typically, these devices utilize a "fill-to-empty" mode that, for the most part, results in emptying of the device in random association with native heart contraction. This type of interaction between the device and assisted ventricle ignores the fact that the overwhelming majority of patients who would be candidates for mechanical assistance have at least some significant residual cardiac function."

[0401] U.S. Pat. No. 5,702,430 also discloses that "It is preferable to allow the natural heart, no matter how badly damaged or diseased it may be, to continue contributing to the required cardiac output whenever possible so that ventricular hemodynamics are disturbed as little as possible. This points away from the use of total cardiac replacements and suggests the use of "assist" devices whenever possible. However, the use of assist devices also poses a very difficult problem: in patients suffering from severe heart disease, temporary or intermittent crises often require artificial pumps to provide "bridging" support which is sufficient to entirely replace ventricular pumping capacity for limited periods of time, such as in the hours or days following a heart attack or cardiac arrest, or during periods of severe tachycardia or fibrillation."

[0402] U.S. Pat. No. 5,702,430 also discloses that "Accordingly, an important goal during development of the described method of pump implantation and use and of the surgically implantable reciprocating pump was to design a method and a device which could cover a wide spectrum of requirements by providing two different and distinct functions. First, an ideal cardiac pumping device should be able to provide "total" or "complete" pumping support which can keep the patient alive for brief or even prolonged periods, if the patient's heart suffers from a period of total failure or severe inadequacy. Second, in addition to being able to provide total pumping support for the body during brief periods, the pump should also be able to provide a limited "assist" function. It should be able to interact with a beating heart in a cooperative manner, with minimal disruption of the blood flow generated by the natural heartbeat. If a ventricle is still functional and able to contribute to cardiac output, as is the case in the overwhelming majority of clinical applications, then the pump will assist or augment the residual cardiac output. This allows it to take advantage of the natural, non-hemolytic pumping action of the heart to the fullest extent possible; it minimizes red blood cell lysis, it reduces mechanical stress on the pump, and it allows longer pump life and longer battery life."

[0403] "Several types of surgically implantable blood pumps containing a piston-like member have been developed to provide a mechanical device for augmenting or even totally replacing the blood pumping action of a damaged or diseased mammalian heart."

[0404] "U.S. Pat. No. 3,842,440 to Karlson discloses an implantable linear motor prosthetic heart and control system containing a pump having a piston-like member which is reciprocal within a magnetic field. The piston-like member includes a compressible chamber in the prosthetic heart which communicates with the vein or aorta."

[0405] U.S. Pat. No. 5,702,430 also discloses that "U.S. Pat. Nos. 3,911,897 and 3,911,898 to Leachman, Jr. disclose heart assist devices controlled in the normal mode of operation to copulsate and counterpulsate with the heart, respectively, and produce a blood flow waveform corresponding to the blood flow waveform of the heart being assisted. The heart assist device is a pump connected serially between the discharge of a heart ventricle and the vascular system. The pump may be connected to the aorta between the left ventricle discharge immediately adjacent the aortic valve and a ligation in the aorta a short distance from the discharge. This pump has coaxially aligned cylindrical inlet and discharge pumping chambers of the same diameter and a reciprocating piston in one chamber fixedly connected with a reciprocating piston of the other chamber. The piston pump further includes a passageway leading between the inlet and discharge chambers and a check valve in the passageway preventing flow from the discharge chamber into the inlet chamber. There is no flow through the movable element of the piston."

[0406] U.S. Pat. No. 5,702,430 also discloses that "U.S. Pat. No. 4,102,610 to Taboada et al. discloses a magnetically operated constant volume reciprocating pump which can be used as a surgically implantable heart pump or assist. The reciprocating member is a piston carrying a tilting-disk type check valve positioned in a cylinder. While a tilting disk valve results in less turbulence and applied shear to surrounding fluid than a squeezed flexible sack or rotating impeller, the shear applied may still be sufficiently excessive so as to cause damage to red blood cells."

[0407] U.S. Pat. No. 5,702,430 also discloses that "U.S. Pat. Nos. 4,210,409 and 4,375,941 to Child disclose a pump used to assist pumping action of the heart having a piston movable in a cylindrical casing in response to magnetic forces. A tilting-disk type check valve carried by the piston provides for flow of fluid into the cylindrical casing and restricts reverse flow. A plurality of longitudinal vanes integral with the inner wall of the cylindrical casing allow for limited reverse movement of blood around the piston which may result in compression and additional shearing of red blood cells. A second fixed valve is present in the inlet of the valve to prevent reversal of flow during piston reversal."

[0408] U.S. Pat. No. 5,702,430 also discloses that "U.S. Pat. No. 4,965,864 to Roth discloses a linear motor using multiple coils and a reciprocating element containing permanent magnets which is driven by microprocessor-controlled power semiconductors. A plurality of permanent magnets is mounted on the reciprocating member. This design does not provide for self-synchronization of the linear motor in the event the stroke of the linear motor is greater than twice the pole pitch on the reciprocating element. During start-up of the motor, or if magnetic coupling is lost, the reciprocating element may slip from its synchronous position by any multiple of two times the pole pitch. As a result, a sensing arrangement must be included in the design to detect the position of the piston so that the controller will not drive it into one end of the closed cylinder. In addition, this design having equal pole pitch and slot pitch results in a "jumpy" motion of the reciprocating element along its stroke.

[0409] U.S. Pat. No. 5,702,430 also discloses that "In addition to the piston position sensing arrangement discussed above, the Roth design may also include a temperature sensor and a pressure sensor as well as control circuitry responsive to the sensors to produce the intended piston motion. For applications such as implantable blood pumps where replacement of failed or malfunctioning sensors requires open heart surgery, it is unacceptable to have a linear motor drive and controller that relies on any such sensors. In addition, the Roth controller circuit uses only NPN transistors thereby restricting current flow to the motor windings to one direction only."

[0410] "U.S. Pat. No. 4,541,787 to Delong describes a pump configuration wherein a piston containing a permanent magnet is driven in a reciprocating fashion along the length of a cylinder by energizing a sequence of coils positioned around the outside of the cylinder. However, the coil and control system configurations disclosed only allow current to flow through one individual winding at a time. This does not make effective use of the magnetic flux produced by each pole of the magnet in the piston. To maximize force applied to the piston in a given direction, current must flow in one direction in the coils surrounding the vicinity of the north pole of the permanent magnet while current flows in the opposite direction in the coils surrounding the vicinity of the south pole of the permanent magnet. Further, during starting of the pump disclosed by Delong, if the magnetic piston is not in the vicinity of the first coil energized, the sequence of coils that are subsequently energized will ultimately approach and repel the magnetic piston toward one end of the closed cylinder. Consequently, the piston must be driven into the end of the closed cylinder before the magnetic poles created by the external coils can become coupled with the poles of the magnetic piston in attraction."

[0411] U.S. Pat. No. 5,702,430 also discloses that "U.S. Pat. No. 4,610,658 to Buchwald et al. discloses an implantable fluid displacement peritoneovenous shunt system. The system comprises a magnetically driven pump having a spool piston fitted with a disc flap valve."

[0412] U.S. Pat. No. 5,702,430 also discloses that "U.S. Pat. No. 5,089,017 to Young et al. discloses a drive system for artificial hearts and left ventricular assist devices comprising one or more implantable pumps driven by external electromagnets. The pump utilizes working fluid, such as sulfur hexafluoride to apply pneumatic pressure to increase blood pressure and flow rate."

[0413] U.S. Pat. No. 5,743,854 discloses a device for inducing and localizing epileptiform activity that is comprised of a direct current (DC) magnetic field generator, a DC power source, and sensors adapted to be coupled to a patient's head; this direct current magnetic field generator may be used in conjunction with the anti-mitotic compound of this invention and/or an auxiliary device and/or tubulin and/or microtubules. In one embodiment of the invention, described in claim 7, the sensors " . . . comprise Foramen Ovale electrodes adapted to be implanted to sense evoked and natural epileptic firings."

[0414] U.S. Pat. No. 5,803,897 discloses a penile prosthesis system comprised of an implantable pressurized chamber, a reservoir, a rotary pump, a magnetically responsive rotor, and a rotary magnetic field generator. Claim 1 of this patent describes: "A penile prosthesis system comprising: at least one pressurizable chamber including a fluid port, said chamber adapted to be located within the penis of a patient for tending to make the penis rigid in response to fluid pressure within said chamber; a fluid reservoir; a rotary pump adapted to be implanted within the body of a user, said rotary pump being coupled to said reservoir and to said chamber, said rotary pump including a magnetically responsive rotor adapted for rotation in the presence of a rotating magnetic field, and an impeller for tending to pump fluid at least from said reservoir to said chamber under the impetus of fluid pressure, to thereby pressurize said chamber in response to operation of said pump; and a rotary magnetic field generator for generating a rotating magnetic field, for, when placed adjacent to the skin of said user at a location near said rotary pump, rotating said magnetically responsive rotor in response to said rotating magnetic field, to thereby tend to pressurize said chamber and to render the penis rigid; controllable valve means operable in response to motion of said rotor of said rotary pump, for tending to prevent depressurization of said chamber when said rotating magnetic field no longer acts on said rotor, said controllable valve means comprising a unidirectional check valve located in the fluid path extending between said rotary pump and said port of said chamber." Such fluid pumping means may be used to facilitate the delivery of the anti-mitotic compound of this invention.

[0415] U.S. Pat. No. 5,810,015 describes an implantable power supply that can convert non-electrical energy (such as mechanical, chemical, thermal, or nuclear energy) into electrical energy; the entire disclosure of this United States patent is hereby incorporated by reference into this specification. This power supply may be used to supply energy to the anti-mitotic compound of this invention and/or to tubulin and/or to microtubules.

[0416] In column 1 of U.S. Pat. No. 5,810,015, a discussion of "prior art" rechargeable power supplies is presented. It is disclosed in this column 1 that: "Modern medical science employs numerous electrically powered devices which are implanted in a living body. For example, such devices may be employed to deliver medications, to support blood circulation as in a cardiac pacemaker or artificial heart, and the like. Many implantable devices contain batteries which may be rechargeable by transcutaneous induction of electromagnetic fields in implanted coils connected to the batteries. Transcutaneous inductive recharging of batteries in implanted devices is disclosed for example in U.S. Pat. Nos. 3,923,060; 4,082,097; 4,143,661; 4,665,896; 5,279,292; 5,314,453; 5,372,605, and many others."

[0417] U.S. Pat. No. 5,810,015 also discloses that: "Other methods for recharging implanted batteries have also been attempted. For example, U.S. Pat. No.4,432,363 discloses use of light or heat to power a solar battery within an implanted device. U.S. Pat. No. 4,661,107 discloses recharging of a pacemaker battery using mechanical energy created by motion of an implanted heart valve." These "other methods" may also be used in the process of this invention.

[0418] U.S. Pat. No. 5,810,015 also discloses that: "A number of implanted devices have been powered without batteries. U.S. Pat. Nos. 3,486,506 and 3,554,199 disclose generation of electric pulses in an implanted device by movement of a rotor in response to the patient's heartbeat. U.S. Pat. No. 3,563,245 discloses a miniaturized power supply unit which employs mechanical energy of heart muscle contractions to generate electrical energy for a pacemaker. U.S. Pat. No. 3,456,134 discloses a piezoelectric converter for electronic implants in which a piezoelectric crystal is in the form of a weighted cantilever beam capable of responding to body movement to generate electric pulses. U.S. Pat. No. 3,659,615 also discloses a piezoelectric converter which reacts to muscular movement in the area of implantation. U.S. Pat. No. 4,453,537 discloses a pressure actuated artificial heart powered by a second implanted device attached to a body muscle which in turn is stimulated by an electric signal generated by a pacemaker." These "other devices" may also be used in the process of this invention.

[0419] U.S. Pat. No. 5,810,015 also discloses that: "In spite of all these efforts, a need remains for efficient generation of energy to supply electrically powered implanted devices." The solution provided by U.S. Pat. No. 5,80,015 is described in claim 1 thereof, which describes: "An implantable power supply apparatus for supplying electrical energy to an electrically powered device, comprising: a power supply unit including: a transcutaneously, invasively rechargeable non-electrical energy storage device (NESD); an electrical energy storage device (EESD); and an energy converter coupling said NESD and said EESD, said converter including means for converting non-electrical energy stored in said NESD to electrical energy and for transferring said electrical energy to said EESD, thereby storing said electrical energy in said EESD."

[0420] An implantable ultrasound communicaton system is disclosed in U.S. Pat. No. 5,861,018, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in the abstract of this patent, there is disclosed in such patent "A system for communicating through the skin of a patient, the system including an internal communication device implanted inside the body of a patient and an external communication device. The external communication device includes an external transmitter which transmits a carrier signal into the body of the patient during communication from the internal communication device to the external communication device. The internal communication device includes an internal modulator which modulates the carrier signal with information by selectively reflecting the carrier signal or not reflecting the carrier signal. The external communication device demodulates the carrier signal by detecting when the carrier signal is reflected and when the carrier signal is not reflected through the skin of the patient. When the reflected carrier signal is detected, it is interpreted as data of a first state, and when the reelected carrier signal is not detected, it is interpreted as data of a second state. Accordingly, the internal communication device consumes relatively little power because the carrier signal used to carry the information is derived from the external communication device. Further, transfer of data is also very efficient because the period needed to modulate information of either the first state or the second state onto the carrier signal is the same. In one embodiment, the carrier signal operates in the ultrasound frequency range."

[0421] U.S. Pat. No. 5,861,019, the entire disclosure of which is hereby incorporated by reference into this specification, discloses a telemetry system for communications between an external programmer and an implantable medical device. Claim 1 of this patent describes: "A telemetry system for communications between an external programmer and an implantable medical device, comprising:the external programmer comprising an external telemetry antenna and an external transceiver for receiving uplink telemetry transmissions and transmitting downlink telemetry transmission through the external telemetry antenna; the implantable medical device comprising an implantable medical device housing, an implantable telemetry antenna and an implantable transceiver for receiving downlink transmissions and for transmitting uplink telemetry transmission through the implantable telemetry antenna, the implantable medical device housing being formed of a conductive metal and having an exterior housing surface and an interior housing surface; the implantable medical device housing being formed with a housing recess extending inwardly from the exterior housing surface to a predetermined housing recess depth in the predetermined substrate area of the exterior housing surface for receiving the dielectric substrate therein; wherein the implantable telemetry antenna is a conformal microstrip antenna formed as part of the implantable medical device housing, the microstrip antenna having electrically conductive ground plane and radiator patch layers separated by a dielectric substrate, layer the conductive radiator patch layer having a predetermined thickness and predetermined radiator patch layer dimensions, the patch layer being formed upon one side of the dielectric substrate layer."

[0422] "An extensive description of the historical development of uplink and downlink telemetry transmission formats" is set forth at columns 2 through 5 of U.S. Pat. No. 5,861,019; such telemetry transmission formats may be used in conjunction with the anti-mitotic compound of this invention. As is disclosed in these columns: "An extensive description of the historical development of uplink and downlink telemetry transmission formats and is set forth in the above-referenced '851 and '963 applications and in the following series of commonly assigned patents all of which are incorporated herein by reference in their entireties. Commonly assigned U.S. Pat. No. 5,127,404 to Grevious et al. sets forth an improved method of frame based, pulse position modulated (PPM) of data particularly for uplink telemetry. The frame-based PPM telemetry format increases bandwidth well above simple PIM or pulse width modulation (PWM) binary bit stream transmissions and thereby conserves energy of the implanted medical device. Commonly assigned U.S. Pat. No. 5,168,871 to Grevious et al. sets forth an improvement in the telemetry system of the '404 patent for detecting uplink telemetry RF pulse bursts that are corrupted in a noisy environment. Commonly assigned U.S. Pat. No. 5,292,343 to Blanchette et al. sets forth a further improvement in the telemetry system of the '404 patent employing a hand shake protocol for maintaining the communications link between the external programmer and the implanted medical device despite instability in holding the programmer RF head steady during the transmission. Commonly assigned U.S. Pat. No. 5,324,315 to Grevious sets forth an improvement in the uplink telemetry system of the '404 patent for providing feedback to the programmer to aid in optimally positioning the programmer RF head over the implanted medical device. Commonly assigned U.S. Pat. No. 5,117,825 to Grevious sets forth a further improvement in the programmer RF head for regulating the output level of the magnetic H field of the RF head telemetry antenna using a signal induced in a sense coil in a feedback loop to control gain of an amplifier driving the RF head telemetry antenna. Commonly assigned U.S. Pat. No. 5,562,714 to Grevious sets forth a further solution to the regulation of the output level of the magnetic H field generated by the RF head telemetry antenna using the sense coil current to directly load the H field. Commonly assigned U.S. Pat. No. 5,354,319 to Wybomey et al. sets forth a number of further improvements in the frame based telemetry system of the '404 patent. Many of these improvements are incorporated into MEDTRONIC.RTM. Model 9760, 9766 and 9790 programmers. These improvements and the improvements described in the above-referenced pending patent applications are directed in general to increasing the data transmission rate, decreasing current consumption of the battery power source of the implantable medical device, and increasing reliability of uplink and downlink telemetry transmissions."

[0423] U.S. Pat. No. 5,810,015 also discloses that: "The current MEDTRONIC.RTM. telemetry system employing the 175 kHz carrier frequency limits the upper data transfer rate, depending on bandwidth and the prevailing signal-to-noise ratio. Using a ferrite core, wire coil, RF telemetry antenna results in: (1) a very low radiation efficiency because of feed impedance mismatch and ohmic losses; 2) a radiation intensity attenuated proportionally to at least the fourth power of distance (in contrast to other radiation systems which have radiation intensity attenuated proportionally to square of distance); and 3) good noise immunity because of the required close distance between and coupling of the receiver and transmitter RF telemetry antenna fields."

[0424] U.S. Pat. No. 5,810,015 also discloses that "These characteristics require that the implantable medical device be implanted just under the patient's skin and preferably oriented with the RF telemetry antenna closest to the patient's skin. To ensure that the data transfer is reliable, it is necessary for the patient to remain still and for the medical professional to steadily hold the RF programmer head against the patient's skin over the implanted medical device for the duration of the transmission. If the telemetry transmission takes a relatively long number of seconds, there is a chance that the programmer head will not be held steady. If the uplink telemetry transmission link is interrupted by a gross movement, it is necessary to restart and repeat the uplink telemetry transmission. Many of the above-incorporated, commonly assigned, patents address these problems."

[0425] U.S. Pat. No. 5,810,015 also discloses that "The ferrite core, wire coil, RF telemetry antenna is not bio-compatible, and therefore it must be placed inside the medical device hermetically sealed housing. The typically conductive medical device housing adversely attenuates the radiated RF field and limits the data transfer distance between the programmer head and the implanted medical device RF telemetry antennas to a few inches."

[0426] U.S. Pat. No. 5,810,015 also discloses that "In U.S. Pat. No. 4,785,827 to Fischer, U.S. Pat. No. 4,991,582 to Byers et al., and commonly assigned U.S. Pat. No. 5,470,345 to Hassler et al. (all incorporated herein by reference in their entireties), the metal can typically used as the hermetically sealed housing of the implantable medical device is replaced by a hermetically sealed ceramic container. The wire coil antenna is still placed inside the container, but the magnetic H field is less attenuated. It is still necessary to maintain the implanted medical device and the external programming head in relatively close proximity to ensure that the H field coupling is maintained between the respective RF telemetry antennas."

[0427] U.S. Pat. No. 5,810,015 also discloses that: "Attempts have been made to replace the ferrite core, wire coil, RF telemetry antenna in the implantable medical device with an antenna that can be located outside the hermetically sealed enclosure. For example, a relatively large air core RF telemetry antenna has been embedded into the thermoplastic header material of the MEDTRONIC.RTM. Prometheus programmable IPG. It is also suggested that the RF telemetry antenna may be located in the IPG header in U.S. Pat. No. 5,342,408. The header area and volume is relatively limited, and body fluid may infiltrate the header material and the RF telemetry antenna."

[0428] U.S. Pat. No. 5,810,015 also discloses that: "In U.S. Pat. Nos. 5,058,581 and 5,562,713 to Silvian, incorporated herein by reference in their entireties, it is proposed that the elongated wire conductor of one or more medical lead extending away from the implanted medical device be employed as an RF telemetry antenna. In the particular examples, the medical lead is a cardiac lead particularly used to deliver energy to the heart generated by a pulse generator circuit and to conduct electrical heart signals to a sense amplifier. A modest increase in the data transmission rate to about 8 Kb/s is alleged in the '581 and '713 patents using an RF frequency of 10-300 MHz. In these cases, the conductor wire of the medical lead can operate as a far field radiator to a more remotely located programmer RF telemetry antenna. Consequently, it is not necessary to maintain a close spacing between the programmer RF telemetry antenna and the implanted cardiac lead antenna or for the patient to stay as still as possible during the telemetry transmission."

[0429] U.S. Pat. No. 5,810,015 also discloses that: "However, using the medical lead conductor as the RF telemetry antenna has several disadvantages. The radiating field is maintained by current flowing in the lead conductor, and the use of the medical lead conductor during the RF telemetry transmission may conflict with sensing and stimulation operations. RF radiation losses are high because the human body medium is lossy at higher RF frequencies. The elongated lead wire RF telemetry antenna has directional radiation nulls that depend on the direction that the medical lead extends, which varies from patient to patient. These considerations both contribute to the requirement that uplink telemetry transmission energy be set artificially high to ensure that the radiated RF energy during the RF uplink telemetry can be detected at the programmer RF telemetry antenna. Moreover, not all implantable medical devices have lead conductor wires extending from the device."

[0430] U.S. Pat. No. 5,810,015 also discloses that: "A further U.S. Pat. No. 4,681,111 to Silvian, incorporated herein by reference in its entirety, suggests the use of a stub antenna associated with the header as the implantable medical device RF telemetry antenna for high carrier frequencies of up to 200 MHz and employing phase shift keying (PSK) modulation. The elimination of the need for a VCO and a bit rate on the order of 2-5% of the carrier frequency or 3.3-10 times the conventional bit rate are alleged."

[0431] U.S. Pat. No. 5,810,015 also discloses that: "At present, a wide variety of implanted medical devices are commercially released or proposed for clinical implantation. Such medical devices include implantable cardiac pacemakers as well as implantable cardioverter-defibrillators, pacemaker-cardioverter-defibrillators, drug delivery pumps, cardiomyostimulators, cardiac and other physiologic monitors, nerve and muscle stimulators, deep brain stimulators, cochlear implants, artificial hearts, etc. As the technology advances, implantable medical devices become ever more complex in possible programmable operating modes, menus of available operating parameters, and capabilities of monitoring increasing varieties of physiologic conditions and electrical signals which place ever increasing demands on the programming system."

[0432] U.S. Pat. No. 5,810,015 also discloses that: "It remains desirable to minimize the time spent in uplink telemetry and downlink transmissions both to reduce the likelihood that the telemetry link may be broken and to reduce current consumption."

[0433] "Moreover, it is desirable to eliminate the need to hold the programmer RF telemetry antenna still and in proximity with the implantable medical device RF telemetry antenna for the duration of the telemetry transmission. As will become apparent from the following, the present invention satisfies these needs."

[0434] The solution to this problem is presented, e.g., in claim 1 of U.S. Pat. No. 5,861,019. This claim describes "A telemetry system for communications between an external programmer and an implantable medical device, comprising:the external programmer comprising an external telemetry antenna and an external transceiver for receiving uplink telemetry transmissions and transmitting downlink telemetry transmission through the external telemetry antenna; the implantable medical device comprising an implantable medical device housing, an implantable telemetry antenna and an implantable transceiver for receiving downlink transmissions and for transmitting uplink telemetry transmission through the implantable telemetry antenna, the implantable medical device housing being formed of a conductive metal and having an exterior housing surface and an interior housing surface; the implantable medical device housing being formed with a housing recess extending inwardly from the exterior housing surface to a predetermined housing recess depth in the predetermined substrate area of the exterior housing surface for receiving the dielectric substrate therein; wherein the implantable telemetry antenna is a conformal microstrip antenna formed as part of the implantable medical device housing, the microstrip antenna having electrically conductive ground plane and radiator patch layers separated by a dielectric substrate, layer the conductive radiator patch layer having a predetermined thickness and predetermined radiator patch layer dimensions, the patch layer being formed upon one side of the dielectric substrate layer."

[0435] U.S. Pat. No. 5,945,762, the entire disclosure of which is hereby incorporated by reference into this specification, discloses an external transmitter adapted to magnetically excite an implanted receiver coil; such an implanted receiver coil may be disposed near, e.g., the anti-mitotic compound of this invention and/or other devices and/or tubulin and/or microtubules. Claim 1 of this patent describes "An external transmitter adapted for magnetically exciting an implanted receiver coil, causing an electrical current to flow in the implanted receiver coil, comprising: (a) a support; (b) a magnetic field generator that is mounted to the support; and (c) a prime mover that is drivingly coupled to an element of the magnetic field generator to cause said element of the magnetic field generator to reciprocate, in a reciprocal motion, said reciprocal motion of said element of the magnetic field generator producing a varying magnetic field that is adapted to induce an electrical current to flow in the implanted receiver coil."

[0436] U.S. Pat. No. 5,954,758, the entire disclosure of which is hereby incorporated by reference into this specification, claims an implantable electrical stimulator comprised of an implantable radio frequency receiving coil, an implantable power supply, an implantable input signal generator, an implantable decoder, and an implantable electrical stimulator. Claim 1 of this patent describes "A system for transcutaneously telemetering position signals out of a human body and for controlling a functional electrical stimulator implanted in said human body, said system comprising: an implantable radio frequency receiving coil for receiving a transcutaneous radio frequency signal; an implantable power supply connected to said radio frequency receiving coil, said power supply converting received transcutaneous radio frequency signals into electromotive power; an implantable input signal generator electrically powered by said implantable power supply for generating at least one analog input movement signal to indicate voluntary bodily movement along an axis; an implantable encoder having an input operatively connected with said implantable input signal generator for encoding said movement signal into output data in a preselected data format; an impedance altering means connected with said encoder and said implantable radio frequency signal receiving coil to selectively change an impedance of said implantable radio frequency signal receiving coil; an external radio frequency signal transmit coil inductively coupled with said implantable radio frequency signal receiving coil, such that impedance changes in said implantable radio frequency signal receiving coil are sensed by said external radio frequency signal transmit coil to establish a sensed modulated movement signal in said external transmit coil; an external control system electrically connected to said external radio frequency transmit coil for monitoring said sensed modulated movement signal in said external radio frequency transmit coil, said external control system including: a demodulator for recovering the output data of said encoder from the sensed modulated ovement signal of said external transmit coil, a pulse width algorithm means for applying a preselected pulse width algorithm to the recovered output data to derive a first pulse width,an amplitude algorithm means for applying an amplitude algorithm to the recovered output data to derive a first amplitude therefrom, an interpulse interval algorithm means for applying an interpulse algorithm to the recovered output data to derive a first interpulse interval therefrom; and,a stimulation pulse train signal generator for generating a stimulus pulse train signal which has the first pulse width and the first pulse amplitude;an implantable functional electrical stimulator for receiving said stimulation pulse train signal from said stimulation pulse train signal generator and generating stimulation pulses with the first pulse width, the first pulse amplitude, and separated by the first interpulse interval; and, at least one electrode operatively connected with the functional electrical stimulator for applying said stimulation pulses to muscle tissue of said human body."

[0437] U.S. Pat. No. 6,006,133, the entire disclosure of which is hereby incorporated by reference into this specification, describes an implantable medical device comprised of a hermetically sealed housing." Such a hermetically sealed housing may be used to contain, e.g., the anti-mitotic compound of this invention.

[0438] U.S. Pat. No. 6,083,166, the entire disclosure of which is hereby incorporated by reference into this specification, discloses an ultrasound transmitter for use with a surgical device. This ultrasound transmitter may be used, e.g., to affect the anti-mitotic compound of this invention and/or tubulin and/or microtubules.

[0439] U.S. Pat. No. 6,152,882, the entire disclosure of which is hereby incorporated by reference into this specification, discloses an implantable electroporation unit, an implantable proble electrode, an implantable reference electrode, and an an amplifier unit; this electroporation unit may be used to treat, e.g., cancer cells in conjunction with the anti-mitotic compound of this invention. Claim 35 of this patent describes: "Apparatus for measurement of monophasic action potentials from an excitable tissue including a plurality of cells, the apparatus comprising: at least one probe electrode placeable adjacent to or in contact with a portion of said excitable tissue; at least one reference electrode placeable proximate said at least one probe electrode; an electroporating unit electrically connected to said at least one probe electrode and said at least one reference electrode for controllably applying to at least some of said cells subjacent said at least one probe electrode electrical current pulses suitable for causing electroporation of cell membranes of said at least some of said cells; and an amplifier unit electrically connected to said at least one probe electrode and to said at least one reference electrode for providing an output signal representing the potential difference between said probe electrode and said reference electrode"

[0440] U.S. Pat. No. 6,169,925, the entire disclosure of which is hereby incorporated by reference into this specification, describes a transceiver for use in communication with an implantable medical device. Claim 1 of this patent describes: "An external device for use in communication with an implantable medical device, comprising: a device controller; a housing; an antenna array mounted to the housing; an RF transceiver operating at defined frequency, coupled to the antenna array; means for encoding signals to be transmitted to the implantable device, coupled to an input of the transceiver; means for decoding signals received from the implantable device, coupled to an output of the transceiver; and means for displaying the decoded signals received from the implantable device; wherein the antenna array comprises two antennas spaced a fraction of the wavelength of the defined frequency from one another, each antenna comprising two antenna elements mounted to the housing and located orthogonal to one another; and wherein the device controller includes means for selecting which of the two antennas is coupled to the transceiver." Such a transceiver, in combination with an implantable sensor, may be used in conjunction with the anti-mitotic compound of this invention and/or tubulin and/or microtubules and/or one or more other implanted devices.

[0441] U.S. Pat. No. 6,185,452, the entire disclosure of which is hereby incorporated by reference into this specification, claims a device for stimulating internal tissue, wherein such device is comprised of: "a sealed elongate housing configured for implantation in said patient's body, said housing having an axial dimension of less than 60 mm and a lateral dimension of less than 6 mm; power consuming circuitry carried by said housing including at least one electrode extending externally of said housing, said power consuming circuitry including a capacitor and pulse control circuitry for controlling (1) the charging of said capacitor and (2) the discharging of said capacitor to produce a current pulse through said electrode; a battery disposed in said housing electrically connected to said power consuming circuitry for powering said pulse control circuitry and charging said capacitor, said battery having a capacity of at least one microwatt-hour; an internal coil and a charging circuit disposed in said housing for supplying a charging current to said battery; an external coil adapted to be mounted outside of said patient's body; and means for energizing said external coil to generate an alternating magnetic field for supplying energy to said charging circuit via said internal coil." Such capacitative discharge energy may be used to affect either the anti-mitotic compound of this invention and/or tubulin and/or microtubules.

[0442] U.S. Pat. No. 6,235,024, the entire disclosure of which is hereby incorporated by reference into this specification, discloses an implantable high frequency energy generator; such high-frequency energy may be used to affect either the anti-mitotic compound of this invention, tubulin, microtubules, and/or one or more other implanted devices. Claim 1 of this patent describes: "A catheter system comprising: an elongate catheter tubing having a distal section, a distal end, a proximal end, and at least one lumen extending between the distal end and the proximal end; a handle attached to the proximal end of said elongate catheter tubing, wherein the handle has a cavity; an ablation element mounted at the distal section of the elongate catheter tubing, the ablation element having a wall with an outer surface and an inner surface, wherein the outer surface is covered with an outer member made of a first electrically conductive material and the inner surface is covered with an inner member made of a second electrically conductive material, and wherein the wall comprises an ultrasound transducer; an electrical conducting means having a first and a second electrical wires, wherein the first electrical wire is coupled to the outer member and the second electrical wire is coupled to the inner member of the ablation element; and a high frequency energy generator means for providing a radiofrequency energy to the ablation element through a first electrical wire of the electrical conducting means."

[0443] An implantable light-generating apparatus is described in claim 16 of U.S. Pat. No. 6,363,279, the entire disclosure of which is hereby incorporated by reference into this specification. In one embodiment, the compound of this invention is comprised of a photolytic linker which is caused to disassociate upon being exposed to specified light energy. As is disclosed in such claim 16, this patent provides a "Heart control apparatus, comprising circuitry for generating a non-excitatory stimulus, and stimulus application devices for applying to a heart or to a portion thereof said non-excitatory stimulus, wherein the circuitry for generating a non-excitatory stimulus generates a stimulus which is unable to generate a propagating action potential and wherein said circuitry comprises a light-generating apparatus for generating light."

[0444] An implantable ultrasound probe is described in claim 1 of U.S. Pat. No. 6,421,565, the entire disclosure of which is hereby incorporated by reference into this specification. Such ultrasound may be used, e.g., to treat the microtubules of cancer cells; and this treatment may be combined, e.g., with the anti-mitotic compounds of this invention.

[0445] Claim 1 of U.S. Pat. No. 6,421,565 describes: "An implantable cardiac monitoring device comprising: an A-mode ultrasound probe adapted for implantation in a right ventricle of a heart, said ultrasound probe emitting an ultrasound signal and receiving at least one echo of said ultrasound signal from at least one cardiac segment of the left ventricle; a unit connected to said ultrasound probe for identifying a time difference between emission of said ultrasound signal and reception of said echo and, from said time difference, determining a position of said cardiac segment, said cardiac segment having a position which, at least when reflecting said ultrasound signal, is correlated to cardiac performance, and said unit deriving an indication of said cardiac performance from said position of said cardiac segment."

[0446] An implantable stent that contains a tube and several optical emitters located on the inner surface of the tube is disclosed in U.S. Pat. No. 6,488,704, the entire disclosure of which is hereby incorporated by reference into this specification. One may use one or more of the implantable devices described in U.S. Pat. No. 6,488,704 together with the anti-mitotic compound of this invention and/or tubulin and/or microtubules and/or another in vivo device.

[0447] Claim 1 of U.S. Pat. No. 6,488,704 describes "1. An implantable stent which comprises: (a) a tube comprising an inner surface and an outer surface, and (b) a multiplicity of optical radiation emitting means adapted to emit radiation with a wavelength from about 30 nanometers to about 30 millimeters, and a multiplicity of optical radiation detecting means adapted to detect radiation with a wavelength of from about 30 nanometers to about 30 millimeters, wherein said optical radiation emitting means and said optical radiation detecting means are disposed on the inside surface of said tube."

[0448] Many other implantable devices and configurations are described in the claims of U.S. Pat. No. 6,488,704. These devices and configurations may be used in conjunction with the anti-mitotic compound of this invention, and/or tubulin, and/or microtubules, and/or other auxiliary, implanted device.

[0449] Thus, e.g., claim 2 of U.S. Pat. No. 6,488,704 discloses that the " . . . implantable stent is comprised of a flexible casing with an inner surface and an outer surface." claim 3 of such patent discloses that the case may be " . . . comprised of fluoropolymer." claim 4 of such patent discloses that the casing may be " . . . optically impermeable."

[0450] Thus, e.g., claim 10 of U.S. Pat. No. 6,488,704 discloses an embodiment in which an implantable stent contains " . . . telemetry means for transmitting a signal to a receiver located external to said implantable stent." The telemetry means may be adapted to receive " . . . a signal from a transmitter located external to said implantable stent (see claim 11); and such signal may be a radio-frequency signal (see claims 12 and 13). The implantable stent may also comprise " . . . telemetry means for transmitting a signal to a receiver located external to said implantable stent" (see claim 22), and/or " . . . . telemetry means for receiving a signal from a transmitter located external to said implantable stent" (see claim 23), and/or " . . . a controller operatively connected to said means for transmitting a signal to said receiver, and operatively connected to said means for receiving a signal from said transmitter" (see claim 24).

[0451] Thus, e.g., claim 14 of U.S. Pat. No. 6,488,704 describes an implantable stent that contains a waveguide array. The waveguide array may contain " . . . a flexible optical waveguide device" (see claim 15), and/or " . . . means for transmitting optical energy in a specified configuration" (see claim 16), and/or " . . . a waveguide interface for receiving said optical energy transmitted in said specified configuration by said waveguide array" (see claim 17), and/ or " . . . means for filtering specified optical frequencies" (see claim 18). The implantable stent may be comprised of " . . . means for receiving optical energy from said waveguide array" (see claim 19), and/or " . . . means for processing said optical energy received from waveguide array" (see claim 20). The implantable stent may comprise " . . . means for processing said radiation emitted by said optical radiation emitting means adapted with a wavelength from about 30 nanometers to about 30 millimeters" (see claim 21).

[0452] The implantable stent of U.S. Pat. No. 6,488,404 may be comprised of implantable laser devices. Thus, e.g., and referring again to U.S. Pat. No. 6,488,704, the implantable stent may be comprised of " . . . a multiplicity of vertical cavity surface emitting lasers and photodetectors arranged in a monolithic configuration" (see claim 27), wherein " . . . said monolithic configuration further comprises a multiplicity of optical drivers operatively connected to said vertical cavity surface emitting lasers" (see claim 28) and/or wherein " . . . said vertical cavity surface emitting lasers each comprise a multiplicity of distributed Bragg reflector layers" (see claim 29), and/or wherein " . . . each of said photodetectors comprises a multiplicity of distributed Bragg reflector layers" (see claim 30), and/or wherein " . . . each of said vertical cavity surface emitting lasers is comprised of an emission layer disposed between a first distributed Bragg reflector layer and a second distributed Bragg reflector layer" (see claim 31), and/or wherein " . . . said emission layer is comprised of a multiplicity of quantum well structures" (see claim 32), and/or wherein " . . . each of said photodetectors is comprised of an absorption layer disposed between a first distributed Bragg reflector layer and a second distributed Bragg reflector layer" (see claim 33), and/or wherein " . . . each of said vertical cavity surface emitting lasers and photodetectors is disposed on a separate semiconductor substrate" (see claim 34), and/or wherein " . . . said semiconductor substrate comprises gallium arsenide." These devices may advantageously be used in the process of this invention.

[0453] Referring again to U.S. Pat. No. 6,488,704, the entire disclosure of which is hereby incorporated by reference into this specification, the implantable stent may be comprised of an arithmetic unit (see claim 37 of such patent), and such arithmetic unit may be " . . . comprised of means for receiving signals from said optical radiation detecting means" (see claim 38), and/or " . . . means for calculating the concentration of components in an analyte disposed within said implantable stent (see claim 39). In one embodiment, "said means for calculating the concentration of components in said analyte calculates concentrations of said components in said analyte based upon optimum optical path lengths for different wavelengths and values of transmitted light (see claim 40).

[0454] Referring again to U.S. Pat. No. 6,488,704, the implantable stent may contain a power supply (see claim 41 thereof) which may contain a battery (see claim 42) which, in one embodiment, is a lithium-iodine battery (see claim 43).

[0455] U.S. Pat. No. 6,585,763, the entire disclosure of which is hereby incorporated by reference into this specification, describes in its claim 1" . . . a vascular graft comprising: a biocompatible material formed into a shape having a longitudinal axis to enclose a lumen disposed along said longitudinal axis of said shape, said lumen positioned to convey fluid through said vascular graft; a first transducer coupled to a wall of said vascular graft; and an implantable circuit for receiving electromagnetic signals, said implantable circuit coupled to said first transducer, said first transducer configured to receive a first energy from said circuit to emit a second energy having one or more frequencies and power levels to alter said biological activity of said medication in said localized area of said body subsequent to implantation of said first transducer in said body near said localized area." One may use the means for " . . . altering said biological activity of said medication . . . " in the process of this invention. The transducer may be selected from the group consisting of " . . . an ultrasonic transducer, a plurality of light sources, an electric field transducer, an electromagnetic transducer, and a resistive heating transducer" (see claim 2), it may comprise a coil (see claim 3), it may comprise " . . . a regular solid including piezoelectric material, and wherein a first resonance frequency, being of said one or more frequencies, is determined by a first dimension of said regular solid and a second resonance frequency, being of said one or more frequencies, is determined by a second dimension of said regular solid and further including a first electrode coupled to said regular solid and a second electrode coupled to said regular solid" (see claim 4).

[0456] U.S. Pat. No. 6,605,089, the entire disclosure of which is hereby incorporated by reference into this specification, discloses an implantable bone growth promoting device. Claim 1 of this patent describes "A device for placement into and between at least two adjacent bone masses to promote bone growth therebetween, said device comprising: an implant having opposed first and second surfaces for placement between and in contact with the adjacent bone masses, a mid-longitudinal axis, and a hollow chamber between said first and second surfaces, said hollow chamber being adapted to hold bone growth promoting material, said hollow chamber being along at least a portion of the mid-longitudinal axis of said implant, each of said first and second surfaces having at least one opening in communication with said hollow chamber into which bone from the adjacent bone masses grows; and an energizer for energizing said implant, said energizer being sized and configured to promote bone growth from adjacent bone mass to adjacent bone mass through said first and second surfaces and through at least a portion of said hollow chamber at the mid-longitudinal axis." The implant may have a coil wrapped around it (see claim 6), a portion of the coil may be " . . . in the form of an external thread on at least a portion of said first and second surfaces of said implant" (see claim 7), the "external thread" may be energized by the "energizer" (claim 8) by conducting " . . . electromagnetic energy to said interior space . . . " of the energizer (claim 9). One may use such "energizer" in the process of this invention.

[0457] Referring again to U.S. Pat. No. 6,605,089, and to the implant claimed therein, the implant may contain " . . . a power supply delivering an electric charge" (see claim 14), and it may comprise " . . . a first portion that is electrically conductive for delivering said electrical charge to at least a portion of the adjacent bone masses and said energizer delivers negative electrical charge to said first portion of said implant" (see claim 15). Additionally, the implant may also contain " . . . a controller for controlling the delivery of said electric charge" that is disposed within the implant (see claim 18), that " . . . includes one of a wave form generator and a voltage generator" (see claim 19), and that " . . . . provides for the delivery of one of an alternating current, a direct current, and a sinusoidal current" (see claim 21).

[0458] U.S. Pat. No. 6,641,520, the entire disclosure of which is hereby incorporated by reference into this specification, discloses a magnetic field generator for providing a static or direct current magnetic field generator; the magnetic field generator described in this patent may be used in conjunction the anti-mitotic compound and/or tubulin and/or microtubules. In column 1 of this patent, some "prior art" magnetic field generators were described; and they also may be so used. It was stated in such column 1 that: "There has recently been an increased interest in therapeutic application of magnetic fields. There have also been earlier efforts of others in this area. The recent efforts, as well as those earlier made, can be categorized into three general types, based on the mechanism for generating and applying the magnetic field. The first type was what could be generally referred to as systemic applications. These were large, tubular mechanisms which could accommodate a human body within them. A patient or recipient could thus be subjected to magnetic therapy through their entire body. These systems were large, cumbersome and relatively immobile. Examples of this type of therapeutic systems included U.S. Pat. Nos. 1,418,903; 4,095,588; 5,084,003; 5,160,591; and 5,437,600. A second type of system was that of magnetic therapeutic applicator systems in the form of flexible panels, belts or collars, containing either electromagnets or permanent magnets. These applicator systems could be placed on or about portion of the recipient's body to allow application of the magnetic therapy. Because of their close proximity to the recipient's body, considerations limited the amount and time duration of application of magnetic therapy. Examples of this type system were U.S. Pat. Nos. 4,757,804; 5,084,003 and 5,344,384. The third type of system was that of a cylindrical or toroidal magnetic field generator, often small and portable, into which a treatment recipient could place a limb to receive electromagnetic therapy. Because of size and other limitations, the magnetic field strength generated in this type system was usually relatively low. Also, the magnetic field was a time varying one. Electrical current applied to cause the magnetic field was time varying, whether in the form of simple alternating current waveforms or a waveform composed of a series of time-spaced pulses."

[0459] The magnetic field generator claimed in U.S. Pat. No. 6,641,520 comprised " . . . . a magnetic field generating coil composed of a wound wire coil generating the static magnetic field in response to electrical power; a mounting member having the coil mounted thereon and having an opening therethrough of a size to permit insertion of a limb of the recipient in order to receive electromagnetic therapy from the magnetic field coil; an electrical power supply furnishing power to the magnetic field coil to cause the coil to generate a static electromagnetic field within the opening of the mounting member for application to the recipient's limb; a level control mechanism providing a reference signal representing a specified electromagnetic field strength set point for regulating the power furnished to the magnetic field coil; a field strength sensor detecting the static electromagnetic field strength generated by the magnetic field coil and forming a field strength signal representing the detected electromagnetic field strength in the opening in the mounting member; a control signal generator receiving the field strength signal from the field strength sensor and the reference signal from the level control mechanism representing a specified electromagnetic field strength set point; and the control signal generator forming a signal to regulate the power flowing from the electrical power supply to the magnetic field coil."

[0460] An implantable sensor is disclosed in U.S. Pat. No. 6,491,639, the entire disclosure of which is hereby incorporated by reference into this specification; this sensor also may be used in conjunction with the anti-mitotic compound of this invention, and/or tubulin, and/or microtubules. Claim 1 of such patent describes: "An implantable medical device including a sensor for use in detecting the hemodynamic status of a patient comprising:a hermetic device housing enclosing device electronics for receiving and processing data; and said device housing including at least one recess and a sensor positioned in said at least one recess. "Claim 10 of such patent describes "10. An implantable medical device including a hemodynamic sensor for monitoring arterial pulse amplitude comprising: a device housing; a transducer comprising a light source and a light detector positioned exterior to said device housing responsive to variations in arterial pulse amplitude; and wherein said light detector receives light originating from said light source and reflected from arterial vasculature of a patient and generates a signal which is indicative of variations in the reflected light caused by the expansion and contraction of said arterial vasculature. "Claim 14 of such patent describes: "14. An implantable medical device including a hemodynamic sensor for monitoring arterial pulse amplitude comprising: a device housing; and an ultrasound transducer associated with said device housing responsive to variations in arterial pulse amplitude." Claim 15 of such patent describes: "15. An implantable medical device including a hemodynamic sensor for monitoring arterial pulse amplitude comprising: a device housing; and a transducer associated with said device housing responsive to variations in arterial pulse amplitude, said device housing having at least one substantially planar face and said transducer is positioned on said planar face." Claim 17 of such patent describes " . . . an implantable pulse generator . . . "

[0461] U.S. Pat. No. 6,663,555, the entire disclosure of which is incorporated by reference into this specification, also claims a magnetic field generator; this magnetic field generator may be used in conjunction with the anti-mitotic compound of this invention and/or tubulin and/or microtubules. Claim 1 of this patent describes: "A magnet keeper-shield assembly for housing a magnet, said magnet keeper-shield assembly comprising: a keeper-shield comprising a material substantially permeable to a magnetic flux; a cavity in the keeper-shield, said cavity comprising an inner side wall and a base, and said cavity being adapted to accept a magnet having a front and a bottom face; an actuator extending through the base; a plurality of springs extending through the base, said springs operative to exert a force in a range from about 175 pounds to about 225 pounds on the bottom face of the magnet in a retracted position, and wherein said magnet produces at least about 118 gauss at a distance of about 10 cm from the front face in the extended position and produces at most about 5 gauss at a distance less than or equal to about 22 cm from the front face in the retracted position."

[0462] Published United States patent application US2002/0182738 discloses an implantable flow cytometer; the entire disclosure of this published United States patent application is hereby incorporated by reference into this specification. Claim 1 of this patent describes "A flow cytometer comprising means for sampling cellular material within a body, means for marking cells within said bodily fluid with a marker to produce marked cells, means for analyzing said marked cells, a first means for removing said marker from said marked cells, a second means for removing said marker from said marked cells, means for sorting said cells within said bodily fluid to produce sorted cells, and means for maintaining said sorted cells cells in a viable state."

[0463] Referring again to published United States patent application US2002/0182738, the implantable flow cytometer may contain " . . . a first control valve operatively connected to said first means for removing said marker from said marked cells and to said second means for removing said marker from said marked cells . . . " (see claim 3), a controller connected to the first control valve (claim 4), a second control valve (claim 5), a third control valve (claim 6), a dye separator (claims 7 and 8), an analyzer for testing blood purity (claim 9), etc.

[0464] A similar flow cytometer is disclosed in published United States patent application US2003/0036718, the entire disclosure of which is also hereby incorporated by reference into this specification.

[0465] Published United States patent application US2003/0036776, the entire disclosure of which is hereby incorporated by reference into this specification, discloses an MRI-compatible implantable device. Claim 1 of this patent describes "A cardiac assist device comprising means for connecting said cardiac assist device to a heart, means for furnishing electrical impulses from said cardiac assist device to said heart, means for ceasing the furnishing of said electrical impulses to said heart, means for receiving pulsed radio frequency fields, means for transmitting and receiving optical signals, and means for protecting said heart and said cardiac assist device from currents induced by said pulsed radio frequency fields, wherein said cardiac assist device contains a control circuit comprised of a parallel resonant frequency circuit and means for activating said parallel resonant frequency circuit." The " . . . means for activating said parallel resonant circuit . . . . " may contain " . . . comprise optical means (see claim 2) such as an optical switch (claim 3) comprised of " . . . a pin type diode . . . " (claim 4) and connected to an optical fiber (claim 5). The optical switch may be " . . . activated by light from a light source . . . " (claim 6), and it may be located with a biological organism (claim 7). The light source may be located within the biological organism (claim 9), and it may provide " . . . light with a wavelength of from about 750 to about 850 nanometers . . . . "

Polymeric Carriers and/or Delivery Systems

[0466] The anti-mitotic compound of this invention may be used in conjunction with prior art polymeric carriers and/or delivery systems comprised of polymeric material.

[0467] In one embodiment, the polymeric material is preferably comprised of one or more anti-mitotic compounds that are adapted to be released from the polymeric material when the polymeric material is disposed within a biological organism. The polymeric material may be, e.g., any of the drug eluting polymers known to those skilled in the art.

[0468] By way of illustration, and referring to U.S. Pat. No. 3,279,996 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be silicone rubber. This patent claims "An implantate for releasing a drug in the tissues of a living organism comprising a drug enclosed in a capsule of silicone rubber, . . . said drug being soluble in and capable of diffusing through said silicone rubber to the outer surface of said capsule . . . . " One may use, as the anti-mitotic compound a material that is soluble in and capable of diffusing through the polymeric material.

[0469] At column 1 of U.S. Pat. No. 3,279,996, other "carrier agents" which may be used as polymeric material are also disclosed, including " . . . beeswax, peanut oil, stearates, etc." Any of these "carrier agents" may be used as the polymeric material.

[0470] By way of further illustration, and as is disclosed in U.S. Pat. No. 4,191,741 (the entire disclosure of which is hereby incorporated by reference into this specification), one may use dimethylpolsiloxane rubber as the polymeric material. This patent claims "A solid, cylindrical, subcutaneous implant for improving the rate of weight gain of ruminant animals which comprises (a) a biocompatible inert core having a diameter of from about 2 to about 10 mm. and (b) a biocompatible coating having a thickness of from about 0.2 to about 1 mm., the composition of said coating comprising from about 5 to about 40 percent by weight of estradiol and from about 95 to about 60 percent by weight of a dimethylpolysiloxane rubber."

[0471] In column 1 of U.S. Pat. No. 4,191,741, other materials which may be used as the polymeric material are disclosed. Thus, it is stated in such patent that "Long et al. U.S. Pat. No. 3,279,996 describes an implant for releasing a drug in the tissues of a living organism comprising the drug enclosed in a capsule formed of silicone rubber. The drug migrates through the silicone rubber wall and is slowly released into the living tissues. A number of biocompatible silicone rubbers are described in the Long et al. patent. When a drug delivery system such as that described in U.S. Pat. No. 3,279,996 is used in an effort to administer estradiol to a ruminant animal a number of problems are encountered. For example, an excess of the drug is generally required in the hollow cavity of the implant. Also, it is difficult to achieve a constant rate of administration of the drug over a long time period such as from 200 to 400 days as would be necessary for the daily administration of estradiol to a growing beef animal. Katz et al. U.S. Pat. No. 4,096,239 describes an implant pellet containing estradiol or estradiol benzoate which has an inert spherical core and a uniform coating comprising a carrier and the drug. The coating containing the drug must be both biocompatible and biosoluble, i.e., the coating must dissolve in the body fluids which act upon the pellet when it is implanted in the body. The rate at which the coating dissolves determines the rate at which the drug is released. Representative carriers for use in the coating material include cholesterol, solid polyethylene glycols, high molecular weight fatty acids and alcohols, biosoluble waxes, cellulose derivatives and solid polyvinyl pyrrolidone." The polymeric material used with the anti-mitotic compound is, in one embodiment, both biocompatible and biosoluble.

[0472] By way of yet further illustration, and referring to U.S. Pat. No. 4,429,080 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be a synthetic absorbable copolymer formed by copolymerizing glycolide with trimethylene carbonate.

[0473] By way of yet further illustration, and referring to U.S. Pat. No. 4,581,028 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be selected from the group consisting of polyester (such as Dacron), polytetrafluoroethylene, polyurethane silicone-based material, and polyamide. The polymeric material of this patent is comprised " . . . of at least one antimicrobial agent selected from the group consisting of the metal salts of sulfonamides." In one embodiment, the polymeric material is comprised of an antimicrobial agent.

[0474] By way of yet further illustration, and referring to U.S. Pat. No. 4,481,353, (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be the bioresorbable polyester disclosed in such patent. U.S. Pat. No. 4,481,353 claims "A bioresorbable polyester in which monomeric subunits are arranged randomly in the polyester molecules, said polyester comprising the condensation reaction product of a Krebs Cycle dicarboxylic acid or isomer or anhydride thereof, chosen for the group consisting of succinic acid, fumaric acid, oxaloacetic acid, L-malic acid, and D-malic acid, a diol having 2, 4, 6, or 8 carbon atoms, and an alpha-hydroxy carboxylic acid chosen from the group consisting of glycolic acid, L-lactic acid and D-lactic acid."

[0475] By way of yet further illustration, and referring to U.S. Pat. No. 4,846,844 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be a silicone polymer matrix in which an anabolic agent (such as an anabolic steroid, or estradiol) is disposed. This patent claims "An implant adapted for the controlled release of an anabolic agent, said implant comprising a silicone polymer matrix, an anabolic agent in said polymer matrix, and an antimicrobial coating, wherein the coating comprises a first-applied non-vulcanizing silicone fluid and a subsequently applied antimicrobial agent in contact with said fluid."

[0476] By way of yet further illustration, and referring to U.S. Pat. No. 4,916,193 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be a copolymer containing carbonate repeat units and ester repeat units (see, e.g., claim 1 of the patent). As disclosed in column 2 of the patent, it may also be "collagen," "homopolymers and copolymers of glycolic acid and lactic acid," "alpha-hydroxy carboxylic acids in conjunction with Krebs cycle dicarboxylic acids and aliphatic diols," "polycarbonate-containing polymers," and "high molecular weight fiber-forming crystalline copolymers of lactide and glycolide." Thus, it is disclosed in such column 2 that: "Various polymers have been proposed for use in the fabrication of bioresorbable medical devices. Examples of absorbable materials used in nerve repair include collagen as disclosed by D. G. Kline and G. J. Hayes, "The Use of a Resorbable Wrapper for Peripheral Nerve Repair, Experimental Studies in Chimpanzees", J. Neurosurgery 21, 737 (1964). Artandi et al., U.S. Pat. No. 3,272,204 (1966) reports the use of collagen protheses that are reinforced with nonabsorbable fabrics. These articles are intended to be placed permanently in a human body. However, one of the disadvantages inherent with collagenous materials, whether utilized alone or in conjunction with biodurable materials, is their potential antigenicity. Other biodegradable polymers of particular interest for medical implantation purposes are homopolymers and copolymers of glycolic acid and lactic acid. A nerve cuff in the form of a smooth, rigid tube has been fabricated from a copolymer of lactic and glycolic acids [The Hand; 10 (3) 259 (1978)]. European patent application No. 118-458-A discloses biodegradable materials used in organ protheses or artificial skin based on poly-L-lactic acid and/or poly-DL-lactic acid and polyester or polyether urethanes. U.S. Pat. No. 4,481,353 discloses bioresorbable polyester polymers, and composites containing these polymers, that are also made up of alpha-hydroxy carboxylic acids, in conjunction with Krebs cycle dicarboxylic acids and aliphatic diols. These polyesters are useful in fabricating nerve guidance channels as well as other surgical articles such as sutures and ligatures. U.S. Pat. Nos. 4,243,775 and 4,429,080 disclose the use of polycarbonate-containing polymers in certain medical applications, especially sutures, ligatures and haemostatic devices. However, this disclosure is clearly limited only to "AB" and "ABA" type block copolymers where only the "B" block contains poly(trimethylene carbonate) or a random copolymer of glycolide with trimethylene carbonate and the "A" block is necessarily limited to glycolide. In the copolymers of this patent, the dominant portion of the polymer is the glycolide component. U.S. Pat. No. 4,157,437 discloses high molecular weight, fiber-forming crystalline copolymers of lactide and glycolide which are disclosed as useful in the preparation of absorbable surgical sutures. The copolymers of this patent contain from about 50 to 75 wt. % of recurring units derived from glycolide."

[0477] By way of further illustration, and referring to U.S. Pat. No. 5,176,907 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be the poly-phosphoester-urethane) described and claimed in claim 1 of such patent. Furthermore, the polymeric material may be one or more of the biodegradable polymers discussed in columns 1 and 2 of such patent. As is disclosed in such columns 1 and 2: "Polymers have been used as carriers of therapeutic agents to effect a localized and sustained release (Controlled Drug Delivery, Vol. I and II, Bruck, S. D., (ed.), CRC Press, Boca Raton, Fla., 1983; Leong, et al., Adv. Drug Delivery Review, 1:199, 1987). These anti-mitotic compound delivery systems simulate infusion and offer the potential of enhanced therapeutic efficacy and reduced systemic toxicity." The polymeric material may be such a poly-phosphoester-urethane.

[0478] U.S. Pat. No. 5,176,907 also discloses "For a non-biodegradable matrix, the steps leading to release of the anti-mitotic compound are water diffusion into the matrix, dissolution of the therapeutic agent, and out-diffusion of the anti-mitotic compound through the channels of the matrix. As a consequence, the mean residence time of the anti-mitotic compound existing in the soluble state is longer for a non-biodegradable matrix than for a biodegradable matrix where a long passage through the channels is no longer required. Since many pharmaceuticals have short half-lives it is likely that the anti-mitotic compound is decomposed or inactivated inside the non-biodegradable matrix before it can be released. This issue is particularly significant for many bio-macromolecules and smaller polypeptides, since these molecules are generally unstable in buffer and have low permeability through polymers. In fact, in a non-biodegradable matrix, many bio-macromolecules will aggregate and precipitate, clogging the channels necessary for diffusion out of the carrier matrix. This problem is largely alleviated by using a biodegradable matrix which allows controlled release of the therapeutic agent. Biodegradable polymers differ from non-biodegradable polymers in that they are consumed or biodegraded during therapy. This usually involves breakdown of the polymer to its monomeric subunits, which should be biocompatible with the surrounding tissue. The life of a biodegradable polymer in vivo depends on its molecular weight and degree of cross-linking; the greater the molecular weight and degree of crosslinking, the longer the life. The most highly investigated biodegradable polymers are polylactic acid (PLA), polyglycolic acid (PGA), polyglycolic acid (PGA), copolymers of PLA and PGA, polyamides, and copolymers of polyamides and polyesters. PLA, sometimes referred to as polylactide, undergoes hydrolytic de-esterification to lactic acid, a normal product of muscle metabolism. PGA is chemically related to PLA and is commonly used for absorbable surgical sutures, as is the PLA/PGA copolymer. However, the use of PGA in controlled-release implants has been limited due to its low solubility in common solvents and subsequent difficulty in fabrication of devices." The polymeric material 14 may be a biodegradable polymeric material.

[0479] U.S. Pat. No. 5,176,907 also discloses "An advantage of a biodegradable material is the elimination of the need for surgical removal after it has fulfilled its mission. The appeal of such a material is more than simply for convenience. From a technical standpoint, a material which biodegrades gradually and is excreted over time can offer many unique advantages."

[0480] U.S. Pat. No. 5,176,907 also discloses "A biodegradable thereapeutic agent delivery system has several additional advantages: 1) the therapeutic agent release rate is amenable to control through variation of the matrix composition; 2) implantation can be done at sites difficult or impossible for retrieval; 3) delivery of unstable therapeutic agents is more practical. This last point is of particular importance in light of the advances in molecular biology and genetic engineering which have lead to the commercial availability of many potent bio-macromolecules. The short in vivo half-lives and low GI tract absorption of these polypeptides render them totally unsuitable for conventional oral or intravenous administration. Also, because these substances are often unstable in buffer, such polypeptides cannot be effectively delivered by pumping devices."

[0481] U.S. Pat. No. 5,176,907 also discloses "In its simplest form, a biodegradable therapeutic agent delivery system consist of a dispersion of the drug solutes in a polymer matrix. The therapeutic agent is released as the polymeric matrix decomposes, or biodegrades into soluble products which are excreted from the body. Several classes of synthetic polymers, including polyesters (Pitt, et al., in Controlled Release of Bioactive Materials, R. Baker, Ed., Academic Press, New York, 1980); polyamides (Sidman, et al., Journal of Membrane Science, 7:227, 1979); polyurethanes (Maser, et al., Journal of Polymer Science, Polymer Symposium, 66:259,1979); polyorthoesters (Heller, et al., Polymer Engineering Science, 21:727,1981); and polyanhydrides (Leong, et al., Biomaterials, 7:364, 1986) have been studied for this purpose." The "therapeutic agent" used in this (and other) patents may be the anti-mitotic compound of this invention.

[0482] By way of yet further illustration, and referring to U.S. Pat. No. 5,194,581 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may the poly (phosphoester) compositions described in such patent.

[0483] The polymeric material may be in the form of microcapsules within which the anti-mitotic compound of this invention is disposed. Thus, one may use microcapusels such as, e.g., the microcapsule described in U.S. Pat. No. 6,117,455, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in the abstract of this patent, there is provided "A sustained-release microcapsule contains an amorphous water-soluble pharmaceutical agent having a particle size of from 1 nm-10 .mu.m and a polymer. The microcapsule is produced by dispersing, in an aqueous phase, a dispersion of from 0.001-90% (w/w) of an amorphous water-soluble pharmaceutical agent in a solution of a polymer having a wt. avg. molecular weight of 2,000-800,000 in an organic solvent to prepare an s/o/w emulsion and subjecting the emulsion to in-water drying."

[0484] In one embodiment, disclosed in U.S. Pat. No. 5,484,584 (the entire disclosure of which is hereby incorporated by reference into this specification), a poly (benzyl-L-glutamate) microsphere is disclosed (see, e.g., claim 10); the anti-mitotic compound of this invention may be disposed within and/or on the surface of such microsphere. As is disclosed in the abstract of this patent, "The present invention relates to a highly efficient method of preparing modified microcapsules exhibiting selective targeting. These microcapsules are suitable for encapsulation surface attachment of therapeutic and diagnostic agents. In one aspect of the invention, surface charge of the polymeric material is altered by conjugation of an amino acid ester to the providing improved targeting of encapsulated agents to specific tissue cells. Examples include encapsulation of radiodiagnostic agents in 1 .mu.m capsules to provide improved opacification and encapsulation of cytotoxic agents in 100 .mu.m capsules for chemoembolization procedures. The microcapsules are suitable for attachment of a wide range of targeting agents, including antibodies, steroids and drugs, which may be attached to the microcapsule polymer before or after formation of suitably sized microcapsules. The invention also includes microcapsules surface modified with hydroxyl groups. Various agents such as estrone may be attached to the microcapsules and effectively targeted to selected organs."

[0485] The release rate of the anti-mitotic compound from the polymeric material may be varied in, e.g., the manner suggested in column 6 of U.S. Pat. No. 5,194,581, the entire disclosure of which is hereby incorporated by reference into this specification. As is disclosed in such column 6, "A wide range of degradation rates can be obtained by adjusting the hydrophobicities of the backbones of the polymers and yet the biodegradability is assured. This can be achieved by varying the functional groups R or R'. The combination of a hydrophobic backbone and a hydrophilic linkage also leads to heterogeneous degradation as cleavage is encouraged, but water penetration is resisted." As is disclosed at column 9 of such patent, "The rate of biodegradation of the poly(phosphoester) compositions of the invention may also be controlled by varying the hydrophobicity of the polymer. The mechanism of predictable degradation preferably relies on either group R' in the poly(phosphoester) backbone being hydrophobic for example, an aromatic structure, or, alternatively, if the group R' is not hydrophobic, for example an aliphatic group, then the group R is preferably aromatic. The rates of degradation for each poly(phosphoester) composition are generally predictable and constant at a single pH. This permits the compositions to be introduced into the individual at a variety of tissue sites. This is especially valuable in that a wide variety of compositions and devices to meet different, but specific, applications may be composed and configured to meet specific demands, dimensions, and shapes--each of which offers individual, but different, predictable periods for degradation. When the composition of the invention is used for long term delivery of an anti-mitotic compound a relatively hydrophobic backbone matrix, for example, containing bisphenol A, is preferred. It is possible to enhance the degradation rate of the poly(phosphoester) or shorten the functional life of the device, by introducing hydrophilic or polar groups, into the backbone matrix. Further, the introduction of methylene groups into the backbone matrix will usually increase the flexibility of the backbone and decrease the crystallinity of the polymer. Conversely, to obtain a more rigid backbone matrix, for example, when used orthopedically, an aromatic structure, such as a diphenyl group, can be incorporated into the matrix. Also, the poly(phosphoester) can be crosslinked, for example, using 1,3,5-trihydroxybenzene or (CH2 OH)4 C, to enhance the modulus of the polymer. Similar considerations hold for the structure of the side chain (R)."

[0486] By way of yet further illustration, and referring to U.S. Pat. No. 5,252,713 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be a polypeptide comprising at least one drug-binding domain that non-covalently binds a drug. The means of identifying and isolating such a polypeptide is described at columns 5-7 of the patent, wherein it is disclosed that: "The process of isolating a polymeric carrier from a drug-binding, large molecular weight protein begins with the identification of a large protein that can non-covalently bind the drug of interest. Examples of such protein/drug pairs are shown in Table I. The drugs in the Table (other than the steroids) are anti-cancer drugs . . . "

[0487] As is also disclosed in U.S. Pat. No. 5,252,713, "Other drug-binding proteins may be identified by appropriate analytical procedures, including Western blotting of large proteins or protein fragments and subsequent incubation with a detectable form of drug. Alternative procedures include combining a drug and a protein in a solution, followed by size exclusion HPLC gel filtration, thin-layer chromatography (TLC), or other analytical procedures that can discriminate between free and protein-bound drug. Detection of drug binding can be accomplished by using radiolabeled, fluorescent, or colored drugs and appropriate detection methods. Equilibrium dialysis with labeled drug may be used. Alternative methods include monitoring the fluorescence change that occurs upon binding of certain drugs (e.g., anthracyclines or analogs thereof, which should be fluorescent) . . . . "In one detection method, drug and protein are mixed, and an aliquot of this solution (not exceeding 5% of the column volume of an HPLC column, such as a Bio-sil TSK-250 7.5.times.30 cm column) is loaded onto the HPLC column. The flow rate is 1 ml/min. The drug bound to protein will elute first, in a separate peak, followed by free drug, eluting at a position characteristic of its molecular weight. If the drug is doxorubicin, both a 280-nm as well as a 495-nm adsorptive peak will correspond to the elution position of the protein if interaction occurs. The elution peaks for other drugs will indicate whether drug binding occurs . . . . "

[0488] As is also disclosed in U.S. Pat. No. 5,252,713, "Knowledge of the chemical structure of a particular drug (i.e., whether chemically reactive functional groups are present) allows one to predict whether covalent binding of the drug to a given protein can occur. Additional methods for determining whether drug binding is covalent or non-covalent include incubating the drug with the protein, followed by dialysis or subjecting the protein to denaturing conditions. Release of the drug from the drug-binding protein during these procedures indicates that the drug was non-covalently bound. Usually, a dissociation constant of about 10-15 M or less indicates covalent or extremely tight non-covalent binding . . . . "

[0489] As is also disclosed in U.S. Pat. No. 5,252,713, "During dialysis, non-covalently bound drug molecules are released over time from the protein and pass through a dialysis membrane, whereas covalently bound drug molecules are retained on the protein. An equilibrium constant of about 10-5 M indicates non-covalent binding. Alternatively, the protein may be subjected to denaturing conditions; e.g., by gel electrophoresis on a denaturing (SDS) gel or on a gel filtration column in the presence of a strong denaturant such as 6M guanidine. Covalently bound drug molecules remain bound to the denatured protein, whereas non-covalently bound drug molecules are released and migrate separately from the protein on the gel and are not retained with the protein on the column."

[0490] As is also disclosed in U.S. Pat. No. 5,252,713, "Once a protein that can non-covalently bind a particular drug of interest is identified, the drug-binding domain is identified and isolated from the protein by any suitable means. Protein domains are portions of proteins having a particular function or activity (in this case, non-covalent binding of drug molecules). The present invention provides a process for producing a polymeric carrier, comprising the steps of generating peptide fragments of a protein that is capable of non-covalently binding a drug and identifying a drug-binding peptide fragment, which is a peptide fragment containing a drug-binding domain capable of non-covalently binding the drug, for use as the polymeric carrier."

[0491] As is also disclosed in U.S. Pat. No. 5,252,713, "One method for identifying the drug-binding domain begins with digesting or partially digesting the protein with a proteolytic enzyme or specific chemicals to produce peptide fragments. Examples of useful proteolytic enzymes include lys-C-endoprotease, arg-C-endoprotease, V8 protease, endoprolidase, trypsin, and chymotrypsin. Examples of chemicals used for protein digestion include cyanogen bromide (cleaves at methionine residues), hydroxylamine (cleaves the Asn-Gly bond), dilute acetic acid (cleaves the Asp-Pro bond), and iodosobenzoic acid (cleaves at the tryptophane residue). In some cases, better results may be achieved by denaturing the protein (to unfold it), either before or after fragmentation."

[0492] As is also disclosed in U.S. Pat. No. 5,252,713, "The fragments may be separated by such procedures as high pressure liquid chromatography (HPLC) or gel electrophoresis. The smallest peptide fragment capable of drug binding is identified using a suitable drug-binding analysis procedure, such as one of those described above. One such procedure involves SDS-PAGE gel electrophoresis to separate protein fragments, followed by Western blotting on nitrocellulose, and incubation with a colored drug like adriamycin. The fragments that have bound the drug will appear red. Scans at 495 nm with a laser densitometer may then be used to analyze (quantify) the level of drug binding."

[0493] As is also disclosed in U.S. Pat. No. 5,252,713, "Preferably, the smallest peptide fragment capable of non-covalent drug binding is used. It may occasionally be advisable, however, to use a larger fragment, such as when the smallest fragment has only a low-affinity drug-binding domain."

[0494] As is also disclosed in U.S. Pat. No. 5,252,713, "The amino acid sequence of the peptide fragment containing the drug-binding domain is elucidated. The purified fragment containing the drug-binding region is denatured in 6M guanidine hydrochloride, reduced and carboxymethylated by the method of Crestfield et al., J. Biol. Chem. 238:622,1963. As little as 20 to 50 picomoles of each peptide fragment can be analyzed by automated Edman degradation using a gas-phase or liquid pulsed protein sequencer (commercially available from Applied Biosystems, Inc.). If the peptide fragment is longer than 30 amino acids, it will most likely have to be fragmented as above and the amino acid sequence patched together from sequences of overlapping fragments."

[0495] As is also disclosed in U.S. Pat. No. 5,252,713, "Once the amino acid sequence of the desired peptide fragment has been determined, the polymeric carriers can be made by either one of two types of synthesis. The first type of synthesis comprises the preparation of each peptide chain with a peptide synthesizer (e.g., commercially available from Applied Biosystems). The second method utilizes recombinant DNA procedures." The polymeric material 14 may comprise one or more of the polymeric carriers described in U.S. Pat. No. 5,252,713.

[0496] As is also disclosed in U.S. Pat. No. 5,252,713, "Peptide amides can be made using 4-methylbenzhydrylamine-derivatized, cross-linked polystyrene-1% divinylbenzene resin and peptide acids made using PAM (phenylacetamidomethyl) resin (Stewart et al., "Solid Phase Peptide Synthesis," Pierce Chemical Company, Rockford, Ill., 1984). The synthesis can be accomplished either using a commercially available synthesizer, such as the Applied Biosystems 430A, or manually using the procedure of Merrifield et al., Biochemistry 21:5020-31,1982; or Houghten, PNAS 82:5131-35,1985. The side chain protecting groups are removed using the Tam-Merrifield low-high HF procedure (Tam et al., J. Am. Chem. Soc. 105:6442-55, 1983). The peptide can be extracted with 20% acetic acid, lyophilized, and purified by reversed-phase HPLC on a Vydac C-4 Analytical Column using a linear gradient of 100% waterto 100% acetonitrile-0.1% trifluoroacetic acid in 50 minutes. The peptide is analyzed using PTC-amino acid analysis (Heinrikson et al., Anal. Biochem. 136:65-74, 1984). After gas-phase hydrolysis (Meltzer et al., Anal. Biochem. 160: 356-61, 1987), sequences are confirmed using the Edman degradation or fast atom bombardment mass spectroscopy. After synthesis, the polymeric carriers can be tested for drug binding using size-exclusion HPLC, as described above, or any of the other analytical methods listed above."

[0497] The polymeric carriers of U.S. Pat. No. 5,252,713 may be used with the anti-mitotic compounds of this invention. As is also disclosed in U.S. Pat. No. 5,252,713, "The polymeric carriers of the present invention preferably comprise more than one drug-binding domain. A polypeptide comprising several drug-binding domains may be synthesized. Alternatively, several of the synthesized drug-binding peptides may be joined together using bifunctional cross-linkers, as described below." The polymeric material in one embodiment, comprises more than one drug-binding domain.

[0498] By way of yet further illustration, and referring to U.S. Pat. No. 5,420,105 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may form a conjugate with a ligand. Thus, and referring to claim 1 of such patent, such conjugate may be "A ligand or an anti-ligand/polymeric carrier/drug conjugate comprising a ligand consisting of biotin or an anti-ligand selected from the group consisting of avidin and streptavidin, which ligand or anti-ligand is covalently bound to a polymeric carrier that comprises at least one drug-binding domain derived from a drug-binding protein, and at least one drug non-covalently bound to the polymeric carrier, wherein the polymeric carrier does not comprise an entire drug-binding protein, but is derived from a drug-binding domain of said drug-binding protein which derivative non-covalently binds a drug which is non-covalently bound by an entire naturally occurring drug-binding protein, and wherein the molecular weight of the polymeric carrier is less than about 60,000 daltons, and wherein said drug is selected from the group consisting of an anti-cancer anthracycline antibiotic, cis-platinum, methotrexate, vinblastine, mitoxanthrone ARA-C, 6-mercaptopurine, 6-mercaptoguanosine, mytomycin C and a steroid."

[0499] The polymeric material form comprise a reservoir (see U.S. Pat. No. 5,447,724) for the anti-mitotic compound(s). Such a reservoir may be constructed in accordance with the procedure described in U.S. Pat. No. 5,447,724, which claims "A medical device at least a portion of which comprises: a body insertable into a patient, said body having an exposed surface which is adapted for exposure to tissue of a patient and constructed to release, at a predetermined rate, therapeutic agent to inhibit adverse physiological reaction of said tissue to the presence of the body of said medical device, said therapeutic agent selected from the group consisting of antithrombogenic agents, antiplatelet agents, prostaglandins, thrombolytic drugs, antiproliferative drugs, antirejection drugs, antimicrobial drugs, growth factors, and anticalcifying agents, at said exposed surface, said body including: an outer polymer metering layer, and an internal polymer layer underlying and supporting said outer polymer metering layer and in intimate contact therewith, said internal polymer layer defining a reservoir for said therapeutic agent, said reservoir formed by a polymer selected from the group consisting of polyurethanes and its copolymers, silicone and its copolymers, ethylene vinylacetate, thermoplastic elastomers, polyvinylchloride, polyolefins, cellulosics, polyamides, polytetrafluoroethylenes, polyesters, polycarbonates, polysulfones, acrylics, and acrylonitrile butadiene styrene copolymers, said outer polymer metering layer having a stable, substantially uniform, predetermined thickness covering the underlying reservoir so that no portion of the reservoir is directly exposed to body fluids and incorporating a distribution of an elutable component which, upon exposure to body fluid, elutes from said outer polymer metering layer to form a predetermined porous network capable of exposing said anti-mitotic compound in said reservoir in said internal polymer layer to said body fluid, said elutable component is selected from the group consisting of polyethylene oxide, polyethylene glycol, polyethylene oxide/polypropylene oxide copolymers, polyhydroxyethylmethacrylate, polyvinylpyrollidone, polyacrylamide and its copolymers, liposomes, albumin, dextran, proteins, peptides, polysaccharides, polylactides, polygalactides, polyanhydrides, polyorthoesters and their copolymers, and soluble cellulosics, said reservoir defined by said internal polymer layer incorporating said therapeutic agent in a manner that permits substantially free outward release of said therapeutic agent from said reservoir into said porous network of said outer polymer metering layer as said elutable component elutes from said polymer metering layer, said predetermined thickness and the concentration and particle size of said elutable component being selected to enable said outer polymer metering layer to meter the rate of outward migration of the thereapuetic agent from said internal reservoir layer through said outer polymer metering layer, said outer polymer metering layer and said internal polymer layer, in combination, enabling prolonged controlled release, at said predetermined rate, of said therapeutic agent at an effective dosage level from said exposed surface of said body of said medical device to the tissue of said patient to inhibit adverse reaction of the patient to the prolonged presence of said body of said medical device in said patient."

[0500] U.S. Pat. No. 5,447,724 also discloses the preparation of the "reservoir" in e.g., in columns 8 and 9 of the patent, wherein it is disclosed that: "A particular advantage of the time-release polymers of the invention is the manufacture of coated articles, i.e., medical instruments. Referring now to FIG. 3, the article to be coated such as a catheter 50 may be mounted on a mandrel or wire 60 and aligned with the preformed apertures 62 (slightly larger than the catheter diameter) in the teflon bottom piece 63 of a boat 64 that includes a mixture 66 of polymer at ambient temperature, e.g., 25.degree. C. To form the reservoir portion, the mixture may include, for example, nine parts solvent, e.g. tetrahydrofuran (THF), and one part Pellthane.RTM. polyurethane polymer which includes the desired proportion of ground sodium heparin particles. The boat may be moved in a downward fashion as indicated by arrow 67 to produce a coating 68 on the exterior of catheter 50. After a short (e.g., 15 minutes) drying period, additional coats may be added as desired. After coating, the catheter 50 is allowed to air dry at ambient temperature for about two hours to allow complete solvent evaporation and/or polymerization to form the reservoir portion. For formation of the surface-layer the boat 64 is cleaned of the reservoir portion mixture and filled with a mixture including a solvent, e.g. THF (9 parts) and Pellthane.RTM. (1 part) having the desired amount of elutable component. The boat is moved over the catheter and dried, as discussed above to form the surface-layer. Subsequent coats may also be formed. An advantage of the dipping method and apparatus described with regard to FIG. 3 is that highly uniform coating thickness may be achieved since each portion of the substrate is successively in contact with the mixture for the same period of time and further, no deformation of the substrate occurs. Generally, for faster rates of movement of the boat 64, thicker layers are formed since the polymer gels along the catheter surfaces upon evaporation of the solvent, rather than collects in the boat as happens with slower boat motion. For thin layers, e.g., on the order of a few mils, using a fairly volatile solvent such as THF, the dipping speed is generally between 26 to 28 cm/min for the reservoir portion and around 21 cm/min for the outer layer for catheters in the range of 7 to 10 F. The thickness of the coatings may be calculated by subtracting the weight of the coated catheter from the weight of the uncoated catheter, dividing by the calculated surface area of the uncoated substrate and dividing by the known density of the coating. The solvent may be any solvent that solubilizes the polymer and preferably is a more volatile solvent that evaporates rapidly at ambient temperature or with mild heating. The solvent evaporation rate and boat speed are selected to avoid substantial solubilizing of the catheter substrate or degradation of a prior applied coating so that boundaries between layers are formed."

[0501] By way of yet further illustration, and referring to U.S. Pat. No. 5,464,650 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may be one or ore of the polymeric materials discussed at columns 4 and 5 of such patent. Referring to such columns 4 and 5, it is disclosed that: "The polymer chosen must be a polymer that is biocompatible and minimizes irritation to the vessel wall when the stent is implanted. The polymer may be either a biostable or a bioabsorbable polymer depending on the desired rate of release or the desired degree of polymer stability, but a bioabsorbable polymer is probably more desirable since, unlike a biostable polymer, it will not be present long after implantation to cause any adverse, chronic local response. Bioabsorbable polymers that could be used include poly(L-lactic acid), polycaprolactone, poly(lactide-co-glycolide), poly(hydroxybutyrate), poly(hydroxybutyrate-co-valerate), polydioxanone, polyorthoester, polyanhydride, poly(glycolic acid), poly(D,L-lactic acid), poly(glycolic acid-co-trimethylene carbonate), polyphosphoester, polyphosphoester urethane, poly(amino acids), cyanoacrylates, poly(trimethylene carbonate), poly(iminocarbonate), copoly(ether-esters) (e.g. PEO/PLA), polyalkylene oxalates, polyphosphazenes and biomolecules such as fibrin, fibrinogen, cellulose, starch, collagen and hyaluronic acid. Also, biostable polymers with a relatively low chronic tissue response such as polyurethanes, silicones, and polyesters could be used and other polymers could also be used if they can be dissolved and cured or polymerized on the stent such as polyolefins, polyisobutylene and ethylene-alphaolefin copolymers; acrylic polymers and copolymers, vinyl halide polymers and copolymers, such as polyvinyl chloride; polyvinyl ethers, such as polyvinyl methyl ether; polyvinylidene halides, such as polyvinylidene fluoride and polyvinylidene chloride; polyacrylonitrile, polyvinyl ketones; polyvinyl aromatics, such as polystyrene, polyvinyl esters, such as polyvinyl acetate; copolymers of vinyl monomers with each other and olefins, such as ethylene-methyl methacrylate copolymers, acrylonitrile-styrene copolymers, ABS resins, and ethylene-vinyl acetate copolymers; polyamides, such as Nylon 66 and polycaprolactam; alkyd resins; polycarbonates; polyoxymethylenes; polyimides; polyethers; epoxy resins, polyurethanes; rayon; rayon-triacetate; cellulose, cellulose acetate, cellulose butyrate; cellulose acetate butyrate; cellophane; cellulose nitrate; cellulose propionate; cellulose ethers; and carboxymethyl cellulose. The ratio of therapeutic substance to polymer in the solution will depend on the efficacy of the polymer in securing the therapeutic substance onto the stent and the rate at which the coating is to release the therapeutic substance to the tissue of the blood vessel. More polymer may be needed if it has relatively poor efficacy in retaining the therapeutic substance on the stent and more polymer may be needed in order to provide an elution matrix that limits the elution of a very soluble therapeutic substance. A wide ratio of therapeutic substance to polymer could therefore be appropriate and could range from about 10:1 to about 1:100."

[0502] By way of yet further illustration, and referring to U.S. Pat. No. 5,470,307 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material may a synthetic or natural polymer, such as polyamide, polyester, polyolefin (polypropylene or polyethylene), polyurethane, latex, acrylamide, methacrylate, polyvinylchloride, polysuflone, and the like; see, e.g., column 11 of the patent.

[0503] In one embodiment, the polymeric material is bound to the anti-mitotic compound by one or more photosensitive linkers. The process of preparing and binding these photosensitive linkers is described in columns 8-9 of U.S. Pat. No. 5,470,307, wherein it is disclosed that: "The process of fabricating a catheter 10 having a desired therapeutic agent 20 connected thereto and then controllably and selectively releasing that therapeutic agent 20 at a remote site within a patient may be summarized in five steps. 1. Formation of Substrate. The substrate layer 16 is formed on or applied to the surface 14 of the catheter body 12, and subsequently or simultaneously prepared for coupling to the linker layer 18. This is accomplished by modifying the substrate layer 16 to expose or add groups such as carboxyls, amines, hydroxyls, or sulfhydryls. In some cases, this may be followed by customizing the substrate layer 16 with an extender 22 that will change the functionality, for example by adding a maleimide group that will accept a Michael's addition of a sulfhydryl at one end of a bifunctional photolytic linker 18. The extent of this derivitization is measured by adding group-specific probes (such as 1 pyrenyl diazomethane for carboxyls, 1 pyrene butyl hydrazine for amines, or Edman's reagent for sulfhydryls Molecular Probes, Inc. of Eugene, Oreg. or Pierce Chemical of Rockford, Ill.) or other fluorescent dyes that may be measured optically or by flow cytometry. The substrate layer 16 can be built up to increase its capacity by several methods, examples of which are discussed below."

[0504] As is also dislosed in U.S. Pat. No. 5,470,307, "2. Selection of Photolytic Release Mechanism. A heterobifunctional photolytic linker 18 suitable for the selected therapeutic agent d20 and designed to couple readily to the functionality of the substrate layer 16 is prepared, and may be connected to the substrate layer 16. Alternately, the photolinker 18 may first be bonded to the therapeutic agent 20, with the combined complex of the therapeutic agent 20 and photolytic linker 18 together being connected to the substrate layer 16. 3. Selection of the Therapeutic Agent. Selection of the appropriate therapeutic agent 20 for a particular clinical application will depend upon the prevailing medical practice. One representative example described below for current use in PTCA and PTA procedures involves the amine terminal end of a twelve amino acid peptide analogue of hirudin being coupled to a chloro carbonyl group on the photolytic linker 18. Another representative example is provided below where the therapeutic agent 20 is a nucleotide such as an antisense oligodeoxynucleotide where a terminal phosphate is bonded by means of a diazoethane located on the photolytic linker 18. A third representative example involves the platelet inhibitor dipyridamole (persantin) that is attached through an alkyl hydroxyl by means of a diazo ethane on the photolytic linker 18. 4. Fabrication of the Linker-Agent Complex and Attachment to the Substrate. The photolytic linker 18 or the photolytic linker 18 with the therapeutic agent 20 attached are connected to the substrate layer 16 to complete the catheter 10. A representative example is a photolytic linker 18 having a sulfhydryl disposed on the non-photolytic end for attachment to the substrate layer 16, in which case the coupling will occur readily in a neutral buffer solution to a maleimide-modified substrate layer 16 on the catheter 10. Once the therapeutic agent 20 has been attached to the catheter 10, it is necessary that the catheter 10 be handled in a manner that prevents damage to the substrate layer 16, photolytic linker layer 18, and therapeutic agent 20, which may include subsequent sterilization, protection from ambient light, heat, moisture, and other environmental conditions that would adversely affect the operation or integrity of the drug-delivery catheter system 10 when used to accomplish a specific medical procedure on a patient."

[0505] In the process of U.S. Pat. No. 5,470,307, the linker is preferably bound to the polymeric material through a modified functional group. The preparation of such modified functional groups is discussed at columns 10-13 of such patent, wherein it is disclosed that: "Most polymers including those discussed herein can be made of materials which have modifiable functional groups or can be treated to expose such groups. Polyamide (nylon) can be modified by acid treatment to produce exposed amines and carboxyls. Polyethylene terephthalate (PET, Dacron.RTM.)) is a polyester and can be chemically treated to expose hydroxyls and carboxyls. Polystyrene has an exposed phenyl group that can be derivitized. Polyethylene and polypropylene (collectively referred to as polyolefins) have simple carbon backbones which can be derivitized by treatment with chromic and nitric acids to produce carboxyl functionality, photocoupling with suitably modified benzophenones, or by plasma grafting of selected monomers to produce the desired chemical functionality. For example, grafting of acrylic acid will produce a surface with a high concentration of carboxyl groups, whereas thiophene or 1,6 diaminocyclohexane will produce a surface containing sulfhydryls or amines, respectively. The surface functionality can be modified after grafting of a monomer by addition of other functional groups. For example, a carboxyl surface can be changed to an amine by coupling 1,6 diamino hexane, or to a sulfhydryl surface by coupling mercapto ethyl amine."

[0506] As is also disclosed in U.S. Pat. No. 5,470,307, "Acrylic acid can be polymerized onto latex, polypropylene, polysulfone, and polyethylene terephthalate (PET) surfaces by plasma treatment. When measured by toluidine blue dye binding, these surfaces show intense modification. On polypropylene microporous surfaces modified by acrylic acid, as much as 50 nanomoles of dye binding per cm2 of external surface area can be found to represent carboxylated surface area. Protein can be linked to such surfaces using carbonyl diimidazole (CDI) in tetrahydrofuran as a coupling system, with a resultant concentration of one nanomole or more per cm2 of external surface. For a 50,000 Dalton protein, this corresponds to 50 pg per cm2, which is far above the concentration expected with simple plating on the surface. Such concentrations of an anti-mitotic compound2o on the angioplasty (PTCA) balloon of a catheter 10, when released, would produce a high concentration of that therapeutic agent 20 at the site of an expanded coronary artery. However, plasma-modified surfaces are difficult to control and leave other oxygenated carbons that may cause undesired secondary reactions"

[0507] As is also disclosed in U.S. Pat. No. 5,470,307, "In the case of balloon dilation catheters 10, creating a catheter body 12 capable of supporting a substrate layer 16 with enhanced surface area can be done by several means known to the art including altering conditions during balloon spinning, doping with appropriate monomers, applying secondary coatings such as polyethylene oxide hydrogel, branched polylysines, or one of the various Starburst..TM. dendrimers offered by the Aldrich Chemical Company of Milwaukee, Wis."

[0508] As is also disclosed in U.S. Pat. No. 5,470,307, "The most likely materials for the substrate layer 16 in the case of a dilation balloon catheter 10 or similar apparatus are shown in FIGS. 1a-1g, including synthetic or natural polymers such as polyamide, polyester, polyolefin (polypropylene or polyethylene), polyurethane, and latex. For solid support catheter bodies 12, usable plastics might include acrylamides, methacrylates, urethanes, polyvinylchloride, polysulfone, or other materials such as glass or quartz, which are all for the most part derivitizable."In one embodiment, depicted in FIG. 1A, the photosensitive linker is bonded to a plastic container 12.

[0509] As is also disclosed in U.S. Pat. No. 5,470,307, "Referring to the polymers shown in FIGS. 1a-1g, polyamide (nylon) is treated with 3-5M hydrochloric acid to expose amines and carboxyl groups using conventional procedures developed for enzyme coupling to nylon tubing. A further description of this process may be obtained from Inman, D. J. and Hornby, W. E., The Iramobilization of Enzymes on Nylon Structures and their Use in Automated Analysis, Biochem. J. 129:255-262 (1972) and Daka, N. J. and Laidler, Flow kinetics of lactate dehydrogenase chemically attached to nylon tubing, K. J., Can. J. Biochem. 56:774-779 (1978). This process will release primary amines and carboxyls. The primary amine group can be used directly, or succinimidyl 4 (p-maleimidophenyl) butyrate (SMBP) can be coupled to the amine function leaving free the maleimide to couple with a sulfhydryl on several of the photolytic linkers 18 described below and acting as an extender 22. If needed, the carboxyl released can also be converted to an amine by first protecting the amines with BOC groups and then coupling a diamine to the carboxyl by means of carbonyl diimidazole (CDI)." The polymeric material 14, and/or the container 12, may comprise or consist essentially of nylon.

[0510] As is also disclosed in U.S. Pat. No. 5,470,307, "Polyester (Dacron.RTM.) can be functionalized using 0.01N NaOH in 10% ethanol to release hydroxyl and carboxyl groups in the manner described by Blassberger, D. et al, Chemically Modified Polyesters as Supports for Enzyme Iramobilization: Isocyanide, Acylhydrazine, and Aminoaryl derivatives of Poly(ethylene Terephthalate), Biotechnol. and Bioeng. 20:309-315 (1978). A diamine is added directly to the etched surface using CDI and then reacted with SMBP to yield the same maleimide reacting group to accept the photolytic linker 18." The polymeric material 14, and/or the container 12, may comprise or consist essentially of polyester."

[0511] As is also disclosed in U.S. Pat. No. 5,470,307, "Polystyrene can be modified many ways, however perhaps the most useful process is chloromethylation, as originally described by Merrifield, R. B., Solid Phase Synthesis. I. The Synthesis of a Tetrapeptide, J. Am. Chem Soc. 85:2149-2154 (1963), and later discussed by Atherton, E. and Sheppard, R. C., Solid Phase Peptide Synthesis: A Practical Approach, pp. 13-23, (IRL Press 1989). The chlorine can be modified to an amine by reaction with anhydrous ammonia." The polymeric material may be comprised of or consist essentially of polystyrene.

[0512] As is also disclosed in U.S. Pat. No. 5,470,307, "Polyolefins (polypropylene or polyethylene) require different approaches because they contain primarily a carbon backbone offering no native functional groups. One suitable approach is to add carboxyls to the surface by oxidizing with chromic acid followed by nitric acid as described by Ngo, T. T. et al., Kinetics of acetylcholinesterase immobilized on polyethylene tubing, Can. J. Biochem. 57:1200-1203 (1979). These carboxyls are then converted to amines by reacting successively with thionyl chloride and ethylene diamine. The surface is then reacted with SMBP to produce a maleimide that will react with the sulfhydryl on the photolytic linker 18." The polymeric material may be comprised of or consist essentially of polyolefin material.

[0513] As is also disclosed in U.S. Pat. No. 5,470,307, "A more direct method is to react the polyolefin surfaces with benzophenone 4-maleimide as described by Odom, O. W. et al, Relaxation Time, Interthiol Distance, and Mechanism of Action of Ribosomal Protein S1, Arch. Biochem Biophys. 230:178-193 (1984), to produce the required group for the sulfhydryl addition to the photolytic linker 18. The benzophenone then links to the polyolefin through exposure to ultraviolet (uv) light. Other methods to derivitize the polyolefin surface include the use of radio frequency glow discharge (RFGD)--also known as plasma discharge--in several different manners to produce an in-depth coating to provide functional groups as well as increasing the effective surface area. Polyethylene oxide (PEO) can be crosslinked to the surface, or polyethylene glycol (PEG) can also be used and the mesh varied by the size of the PEO or PEG. This is discussed more fully by Sheu, M. S., et al., A glow discharge treatment to immobilize poly(ethylene oxide)/poly(propylene oxide) surfactants for wettable and non-fouling biomaterials, J. Adhes. Sci. Tech., 6:995-1009 (1992) and Yasuda, H., Plasma Polymerization, (Academic Press, Inc. 1985). Exposed hydroxyls can be activated by tresylation, also known as trifluoroethyl sulfonyl chloride activation, in the manner described by Nielson, K. and Mosbach, K., Tresyl Chloride-Activated Supports for Enzyme Immobilization (and related articles), Meth. Enzym., 135:65-170 (1987). The function can be converted to amines by addition of ethylene diamine or other aliphatic diamines, and then the usual addition of SMBP will give the required maleimide. Another suitable method is to use RFGD to polymerize acrylic acid or other monomers on the surface of the polyolefin. This surface consisting of carboxyls and other carbonyls is derivitizable with CDI and a diamine to give an amine surface which then can react with SMBP."

[0514] Referring again to the process described in U.S. Pat. No. 5,470,307, photolytic linkers can be conjugated to the functional groups on substrate layers to form linker-agent complexes. As is disclosed in columns 13-14 of such patent, "Once a particular functionality for the substrate layer 16 has been determined, the appropriate strategy for coupling the photolytic linker 18 can be selected and employed. Several such strategies are set out in the examples which follow. As with selecting a method to expose a functional group on the surface 14 of the substrate layer 16, it is understood that selection of the appropriate strategy for coupling the photolytic linker 18 will depend upon various considerations including the chemical functionality of the substrate layer 16, the particular therapeutic agent 20 to be used, the chemical and physical factors affecting the rate and equilibrium of the particular photolytic release mechanism, the need to minimize any deleterious side-effects that might result (such as the production of antagonistic or harmful chemical biproducts, secondary chemical reactions with adjunct medical instruments including other portions of the catheter 10, unclean leaving groups or other impurities), and the solubility of the material used to fabricate the catheter body 12 or substrate layer 16 in various solvents. More limited strategies are available for the coupling of a 2-nitrophenyl photolytic linker 18. If the active site is 1-ethyl hydrazine used in most caging applications, then the complementary functionality on the therapeutic agent 20 will be a carboxyl, hydroxyl, or phosphate available on many pharmaceutical drugs. If a bromomethyl group is built into the photolytic linker 18, it can accept either a carboxyl or one of many other functional groups, or be converted to an amine which can then be further derivitized. In such a case, the leaving group might not be clean and care must be taken when adopting this strategy for a particular anti-mitotic compound 20. Other strategies include building in an oxycarbonyl in the 1-ethyl position, which can form an urethane with an amine in the anti-mitotic compound2o. In this case, the photolytic process evolves CO2."

[0515] Referring again to U.S. Pat. No. 5,470,307, after the photolytic linker construct has been prepared, it may be contacted with a coherent laser light source to release the therapeutic agent. Thus, as is disclosed in column 9 of U.S. Pat. No. 5,470,307, "use of a coherent laser light source 26 will be preferable in many applications because the use of one or more discrete wavelengths of light energy that can be tuned or adjusted to the particular photolytic reaction occurring in the photolytic linker 18 will necessitate only the minimum power (wattage) level necessary to accomplish a desired release of the anti-mitotic compound 20. As discussed above, coherent or laser light sources 26 are currently used in a variety of medical procedures including diagnostic and interventional treatment, and the wide availability of laser sources 26 and the potential for redundant use of the same laser source 26 in photolytic release of the therapeutic agent 20 as well as related procedures provides a significant advantage. In addition, multiple releases of different therapeutic agents 20 or multiple-step reactions can be accomplished using coherent light of different wavelengths, intermediate linkages to dye filters may be utilized to screen out or block transmission of light energy at unused or antagonistic wavelengths (particularly cytotoxic or cytogenic wavelengths), and secondary emitters may be utilized to optimize the light energy at the principle wavelength of the laser source 26. In other applications, it may be suitable to use a light source 26 such as a flash lamp operatively connected to the portion of the body 12 of the catheter 10 on which the substrate 16, photolytic linker layer 18, and anti-mitotic compound20 are disposed. One example would be a mercury flash lamp capable of producing long-wave ultra-violet (uv) radiation within or across the 300-400 nanometer wavelength spectrum. When using either a coherent laser light source 26 or an alternate source 26 such as a flash lamp, it is generally preferred that the light energy be transmitted through at least a portion of the body 12 of the catheter 10 such that the light energy traverses a path through the substrate layer 16 to the photolytic linker layer 18 in order to maximize the proportion of light energy transmitted to the photolytic linker layer 18 and provide the greatest uniformity and reproducibility in the amount of light energy (photons) reaching the photolytic linker layer 18 from a specified direction and nature. Optimal uniformity and reproducibility in exposure of the photolyric linker layer 18 permits advanced techniques such as variable release of the anti-mitotic compound 20 dependent upon the controlled quantity of light energy incident on the substrate layer 16 and photolytic linker layer 18."

[0516] As is also disclosed in U.S. Pat. No. 5,470,307, "The art pertaining to the transmission of light energy through fiber optic conduits 28 or other suitable transmission or production means to the remote biophysical site is extensively developed. For a fiber optic device, the fiber optic conduit 28 material must be selected to accommodate the wavelengths needed to achieve release of the anti-mitotic compound 20 which will for almost all applications be within the range of 280-400 nanometers. Suitable fiber optic materials, connections, and light energy sources 26 may be selected from those currently available and utilized within the biomedical field. While fiber optic conduit 28 materials may be selected to optimize transmission of light energy at certain selected wavelengths for desired application, the construction of a catheter 10 including fiber optic conduit 28 materials capable of adequate transmission throughout the range of the range of 280-400 nanometers is preferred, since this catheter 10 would be usable with the full compliment of photolytic release mechanisms and therapeutic agents 10. Fabrication of the catheter 10 will therefore depend more upon considerations involving the biomedical application or procedure by which the catheter 10 will be introduced or implanted in the patient, and any adjunct capabilities which the catheter 10 must possess."

[0517] By way of yet further illustration, and referring to U.S. Pat. No. 5,599,352 (the entire disclosure of which is hereby incorporated by reference into this specification), the polymeric material can comprise fibrin. As is disclosed in column 4 of such patent, "The present invention provides a stent comprising fibrin. The term "fibrin" herein means the naturally occurring polymer of fibrinogen that arises during blood coagulation. Blood coagulation generally requires the participation of several plasma protein coagulation factors: factors XII, XI, IX, X, VIII, VII, V, XIII, prothrombin, and fibrinogen, in addition to tissue factor (factor III), kallikrein, high molecular weight kininogen, Ca+2, and phospholipid. The final event is the formation of an insoluble, cross-linked polymer, fibrin, generated by the action of thrombin on fibrinogen. Fibrinogen has three pairs of polypeptide chains (ALPHA 2-BETA 2-GAMMA 2) covalently linked by disulfide bonds with a total molecular weight of about 340,000. Fibrinogen is converted to fibrin through proteolysis by thrombin. An activation peptide, fibrinopeptide A (human) is cleaved from the amino-terminus of each ALPHA chain; fibrinopeptide B (human) from the amino-terminus of each BETA chain. The resulting monomer spontaneously polymerizes to a fibrin gel. Further stabilization of the fibrin polymer to an insoluble, mechanically strong form, requires cross-linking by factor XIII. Factor XIII is converted to XIIIa by thrombin in the presence of Ca+2. XIIIa cross-links the GAMMA chains of fibrin by transglutaminase activity, forming EPSILON-(GAMMA-glutamyl) lysine cross-links. The ALPHA chains of fibrin also may be secondarily cross-linked by transamidation."

[0518] As is also disclosed in U.S. Pat. No. 5,599,352, "Since fibrin blood clots are naturally subject to fibrinolysis as part of the body's repair mechanism, implanted fibrin can be rapidly biodegraded. Plasminogen is a circulating plasma protein that is adsorbed onto the surface of the fibrin polymer. The adsorbed plasminogen is converted to plasmin by plasminogen activator released from the vascular endothelium. The plasmin will then break down the fibrin into a collection of soluble peptide fragments."

[0519] As is also disclosed in U.S. Pat. No. 5,599,352, "Methods for making fibrin and forming it into implantable devices are well known as set forth in the following patents and published applications which are hereby incorporated by reference. In U.S. Pat. No. 4,548,736 issued to Muller et al., fibrin is clotted by contacting fibrinogen with a fibrinogen-coagulating protein such as thrombin, reptilase or ancrod. Preferably, the fibrin in the fibrin-containing stent of the present invention has Factor XIII and calcium present during clotting, as described in U.S. Pat. No. 3,523,807 issued to Gerendas, or as described in published European Patent Application 0366564, in order to improve the mechanical properties and biostability of the implanted device. Also preferably, the fibrinogen and thrombin used to make fibrin in the present invention are from the same animal or human species as that in which the stent of the present invention will be implanted in order to avoid cross-species immune reactions. The resulting fibrin can also be subjected to heat treatment at about 150.degree. C. for 2 hours in order to reduce or eliminate antigenicity. In the Muller patent, the fibrin product is in the form of a fine fibrin film produced by casting the combined fibrinogen and thrombin in a film and then removing moisture from the film osmotically through a moisture permeable membrane. In the European Patent Application 0366564, a substrate (preferably having high porosity or high affinity for either thrombin or fibrinogen) is contacted with a fibrinogen solution and with a thrombin solution. The result is a fibrin layer formed by polymerization of fibrinogen on the surface of the device. Multiple layers of fibrin applied by this method could provide a fibrin layer of any desired thickness. Or, as in the Gerendas patent, the fibrin can first be clotted and then ground into a powder which is mixed with water and stamped into a desired shape in a heated mold. Increased stability can also be achieved in the shaped fibrin by contacting the fibrin with a fixing agent such as glutaraldehyde or formaldehyde. These and other methods known by those skilled in the art for making and forming fibrin may be used in the present invention."

[0520] As is also disclosed in U.S. Pat. No. 5,599,352, "Preferably, the fibrinogen used to make the fibrin is a bacteria-free and virus-free fibrinogen such as that described in U.S. Pat. No. 4,540,573 to Neurath et al which is hereby incorporated by reference. The fibrinogen is used in solution with a concentration between about 10 and 50 mg/ml and with a pH of about 5.8-9.0 and with an ionic strength of about 0.05 to 0.45. The fibrinogen solution also typically contains proteins and enzymes such as albumin, fibronectin (0-300 .mu.g per ml fibrinogen), Factor XIII (0-20 .mu.g per ml fibrinogen), plasminogen (0-210 .mu.g per ml fibrinogen), antiplasmin (0-61 .mu.g per ml fibrinogen) and Antithrombin III (0-150 .mu.g per ml fibrinogen). The thrombin solution added to make the fibrin is typically at a concentration of 1 to 120 NIH units/ml with a preferred concentration of calcium ions between about 0.02 and 0.2M."

[0521] As is also disclosed in U.S. Pat. No. 5,599,352, "Polymeric materials can also be intermixed in a blend or co-polymer with the fibrin to produce a material with the desired properties of fibrin with improved structural strength. For example, the polyurethane material described in the article by Soldani et at., "Bioartificial Polymeric Materials Obtained from Blends of Synthetic Polymers with Fibrin and Collagen" International Journal of Artificial Organs, Vol.14, No. 5, 1991, which is incorporated herein by reference, could be sprayed onto a suitable stent structure. Suitable polymers could also be biodegradable polymers such as polyphosphate ester, polyhydroxybutyrate valerate, polyhydroxybutyrate-co-hydroxyvalerate and the like . . . " The polymeric material 14 may be, e.g., a blend of fibrin and another polymeric material.

[0522] As is also disclosed in U.S. Pat. No. 5,599,352, "The shape for the fibrin can be provided by molding processes. For example, the mixture can be formed into a stent having essentially the same shape as the stent shown in U.S. Pat. No. 4,886,062 issued to Wiktor. Unlike the method for making the stent disclosed in Wiktor which is wound from a wire, the stent made with fibrin can be directly molded into the desired open-ended tubular shape."

[0523] As is also disclosed in U.S. Pat. No. 5,599,352, "In U.S. Pat. No. 4,548,736 issued to Muller et al., a dense fibrin composition is disclosed which can be a bioabsorbable matrix for delivery of drugs to a patient. Such a fibrin composition can also be used in the present invention by incorporating a drug or other therapeutic substance useful in diagnosis or treatment of body lumens to the fibrin provided on the stent. The drug, fibrin and stent can then be delivered to the portion of the body lumen to be treated where the drug may elute to affect the course of restenosis in surrounding luminal tissue. Examples of drugs that are thought to be useful in the treatment of restenosis are disclosed in published international patent application WO9112779 "Intraluminal Drug Eluting Prosthesis" which is incorporated herein by reference. Therefore, useful drugs for treatment of restenosis and drugs that can be incorporated in the fibrin and used in the present invention can include drugs such as anticoagulant drugs, antiplatelet drugs, antimetabolite drugs, anti-inflammatory drugs and antimitotic drugs. Further, other vasoreactive agents such as